Question

In: Statistics and Probability

Eight magzines in total. Four magzines are about cooking and four are about sports. If a...

Eight magzines in total. Four magzines are about cooking and four are about sports. If a person randomly choose three magzines from the eight magzines, what will be the probability that all of the magzines the person chosen are about cooking?

And also: what will be the probability of at least one of the three chosen magazines is about sports?

Solutions

Expert Solution

There are total 8 magazines.
4 magazines are about cooking and 4 are about sports.
The first magazine from the 4 cooking magazines can be selected in: 4 ways.
Similarly, The second magazine from the remaining 3 cooking magazines can be selected in: 3 ways.
Similarly, The third magazine from the remaining 2 cooking magazines can be selected in:2 ways.

Now, if we consider the all 8 magazines, then-
The first magazine from the 8 magazines can be selected in: 8 ways.
Similarly, The second magazine from the remaining 7 magazines can be selected in: 7 ways.
Similarly, The third magazine from the remaining 6 magazines can be selected in:6 ways.

P(all of the three magazines are about cooking)=

I hope this clarifies your doubt. If you're satisfied with the solution, hit the Like button. For further clarification, comment below. Thank You. :)


Related Solutions

Answer the following questions: 1. Guests at a busy eight-story four-star hotel are consistently complaining about...
Answer the following questions: 1. Guests at a busy eight-story four-star hotel are consistently complaining about having to wait too long for the elevator. At 8:00am, some of the elevators are in use by the housekeeping department whose associates are going up to begin work on the guest rooms. At the same time, room service has an elevator blocked off to serve in-room breakfasts because the kitchen and the banqueting departments are using the service elevators. Then, at about 10:30...
essay about sports and chinese wushu
essay about sports and chinese wushu
In your opinion are sports leagues monopolies? Do sports stadiums create total surplus for local economies?...
In your opinion are sports leagues monopolies? Do sports stadiums create total surplus for local economies? Do they create deadweight loss? Do you think local governments should help pay for stadiums? How does this relate to the overall economical topic of monopolies?
The sports saga with MRSA continues. A recent article in the NY Times about college sports...
The sports saga with MRSA continues. A recent article in the NY Times about college sports described “To prevent teammates from sharing towels to wipe their faces or arms on the sideline, trainers have sometimes employed a small army of interns who scoop up any used towel so it can quickly be placed in the laundry. Jim Thornton, the athletic trainer at Clarion University in Pennsylvania, said his teams had begun using chemically treated towelettes that are about half the...
Eight Company reported 1,500 units of inventory at a total cost of $15,000 as of November...
Eight Company reported 1,500 units of inventory at a total cost of $15,000 as of November 1, 2018. The following transactions occurred during the month. November 14: The company purchased 2,000 units of merchandise on account for $22,000 with terms 2/10, n30. The goods were shipped f.o.b. destination and arrived at the company's warehouse on November 18. The company paid $500 cash to a third party carrier for freight. November 18: The company received the inventory purchased on November 14....
Below are the DNA sequences that encode the first eight amino acids for four alleles of...
Below are the DNA sequences that encode the first eight amino acids for four alleles of the Adh protein in Drosophila melanogaster. Nucleotides that differ from the first sequence are shown by a lowercase letter. ATGTCTCTCACCAACAAGAACGTC ATGgCTCTCACCAACAAGAACGTC ATGTCgCTCACCAACAAGAACGTC ATGTCTtTgACCAACAAGAACGTC a. What are the first eight amino acids for each of these four DNA sequences? b. For each of the four polymorphic sites, indicate whether the site represents a synonymous or nonsynonymous polymorphism. c. Synonymous polymorphisms tend to be more common...
Below are the DNA sequences that encode the first eight amino acids for four alleles of...
Below are the DNA sequences that encode the first eight amino acids for four alleles of the Adh protein in Drosophila melanogaster. Nucleotides that differ from the first sequence are shown by a lowercase letter. ATGTCTCTCACCAACAAGAACGTC ATGgCTCTCACCAACAAGAACGTC ATGTCgCTCACCAACAAGAACGTC ATGTCTtTgACCAACAAGAACGTC a. What are the first eight amino acids for each of these four DNA sequences? b. For each of the four polymorphic sites, indicate whether the site represents a synonymous or nonsynonymous polymorphism. c. Synonymous polymorphisms tend to be more common...
Apply the techniques of two-way ANOVA to a data sample split into eight treatments with total...
Apply the techniques of two-way ANOVA to a data sample split into eight treatments with total degrees of freedom, df = 47, testing at the 2.5% level of significance. The Sum of Squares for Treatments is 42; the Mean Square for Blocks is 9, and the Mean Square for Error is 3. SS df MS F test Stats Treatments #1 #5 #9 #12 Blocks #2 #6 #10 #13 Error #3 #7 #11 XXXXXXX Total #4 #8 XXXXXXX XXXXXXX #14: What...
cooking receipe teas
cooking receipe teas
An experiment has been conducted for four treatments with eight blocks. Complete the following analysis of...
An experiment has been conducted for four treatments with eight blocks. Complete the following analysis of variance table (to 2 decimals, if necessary and p-value to 4 decimals). If your answer is zero enter "0". Source of Variation Sum of Squares Degrees of Freedom Mean Square F p-value Treatments 1,100 Blocks 500 Error Total 2,200 Use  = .05 to test for any significant differences
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT