Question

You have the following coding sequence for a gene and need to generate billions of copies to study it. Answer the following questions:

A. What is the full name for the technique used to generate billions of copies of your sequence of interest?

B. What type of nucleotides will you include in your reaction mix?

C. Why won't the DNA polymerase from your own cells work in the reaction mix?

D. What are the sequences of the primer pair (5 base pair in lenght) you would need to amplify ALL of your sequence of interest?

Sequence of interest:

5'ACCGACTATGCGGACTACGCGGGATCAAGGATCTGACT3'

Answer 1

A. PCR - Polymerase Chain Reaction is the technique used to generate billions of copies of sequence of our interest

B. Deoxynucleotides is added to the reaction mix. Deoxynucleotides are the buliding blocks of DNA which has a deoxyribose sugar, nitrogenous base (adenine, guanine, cytosine and thymine) and phosphate group.

C, The DNA polymerase required in PCR mixture should be heat tolerant i.e., in the PCR reaction, we have three different cycles that differs in temperature. the first step denaturation- requires about 95 degree Celcius, Annealing requires-50-60 degree celcius, Extension-72 degree Celcius. The DNA polymerase of our cells becomes non functional when subjected to such high temperature. This is why Taq Polymerase is used. It is heat resistant Polymerase.

D, Polymerases- let it be DNA Polymerase or Taq Polymerase, it requires the 3' end to do its function. So the primers should be designed from both the 3' ends of the ds DNA.

A primer is a generally a sequence of 16-22 nt long, whch is used as the starting sequnec to which the Taq polymerase binds and syntheses the DNA

FP5'---------->3'

5'-------------------------------------3'

3'-------------------------------------5'

3' <---------------- 5'RP

Forward primer function is to help in synthesis of  the top strand, so we need primer binding site which is complementary to the top strand. So the primer binds to the 3'-OH of the complemetary strand. The sequnec of the FP will be similar to the first few sequences of the top starnd.

The function of Reverse primer is to help in synthesis of the complementary strand, so we need primer binding site which is complementary to the this strand. SO the primers binds to the 3' OH of the top strand. the sequence of RP will be similar to the last few sequences of the complementary strand.

the given sequence is

5'- ACCGACTATG..........................TCTGACT-3'

3'-TGGCTGATAC...........................AGACTGA-5'

The forward primer that we design should bind to the 3' end of the complementary strand, so that it synthesis the top strand. the reverse primer should bind to the 3' end of the topmost strand, so that it synthesis the strand the complementary starnd. So the forward primer will be straightforward i.e., the first five sequence from 5' to 3' strand and the reverse primer will be reverse complementary of the 3' to 5' strand.

So.,

The forward primer is 5'-ACCGA-3'

The reverse primer is 5'-AGTCA-3'