1. Small RNAs that are complementary to mRNA and target it for degradation are known as...

1. Small RNAs that are complementary to mRNA and target it for degradation are known as

a. miRNA

b. tRNA

c. rRNA

d. mRNA

2. When the inducer is absent, the ___________ binds to the operator and no mRNA is synthesized.

a. repressor b. promoter. c. agitator d. combiner

3. Methylated nucleotides are not transcribed in epigenetic control.

TRUE or FALSE

Solutions

Expert Solution

Ans 1-) miRNA is the correct option.

micro RNA are found in viruses, animals and plants. They are defined as the molecule of RNA which is non coding and they functions in silencing of RNA and they play a major role in the post transcriptional regulation. micro RNA base pair with the sequences which are complementary within the mRNA molecule.

Ans 2-) Repressor is the correct option.

In lac operon, the repressor gene will transcribe the repressor protein which is in its active state. And inducer which is a lactose is absent, then this repressor protein will bind to the operator region and not allow the RNA polymerase to sit on the operator region thus RNA polymerase cannot bind to promoter and thus prevent mRNA from transcribing the gene.

Ans 3-) The statement is False.

DNA methylation is a form of epigenetic control will regulate the expression of gene. By the process of DNA methylation, the epigenetic marking of DNA is heritable and stable that will allow the methylated DNA to get transcribed.

gladiator answered 1 year ago

Next > < Previous

Related Solutions

Biology of Stem Cells:Thanks! 1a: A miRNA regulates its target mRNA by degradation. Let’s assume miRNA-199...

Biology of Stem Cells:Thanks! 1a: A miRNA regulates its target mRNA by degradation. Let’s assume miRNA-199 targets Blimp1. Which progenitor population in the developing embryo will be affected? 1b:How does this affect your ability to isolate this progenitor pool?

Contrast and compare briefly the role of riboswitches, small RNAs and anti-sense RNAs in gene expression...

Contrast and compare briefly the role of riboswitches, small RNAs and anti-sense RNAs in gene expression regulation in prokaryotes.

Contrast and compare briefly the role of riboswitches, small RNAs and anti-sense RNAs in gene expression...

Contrast and compare briefly the role of riboswitches, small RNAs and anti-sense RNAs in gene expression regulation in prokaryotes.

Compare groups of small RNAs (snRNAs; RNAi; miRNA; siRNA; piRNA) RISC pathway and RNAs that use...

Compare groups of small RNAs (snRNAs; RNAi; miRNA; siRNA; piRNA) RISC pathway and RNAs that use it

Given the sequence below 5’ AACTTCGGCTTAAATGGAGGCCAT’ What is the complementary DNA strand? What would the mRNA...

Given the sequence below 5’ AACTTCGGCTTAAATGGAGGCCAT’ What is the complementary DNA strand? What would the mRNA strand look like? What would the protein look like? Create a point mutation in the DNA and then give the mRNA and protein sequence. Create a frameshift mutation in the DNA and then give the mRNA and protein sequence.

Repeat-associated small-interfering RNAs (rasiRNAs) account for 90-95% of the global small RNA population in all plant...

Repeat-associated small-interfering RNAs (rasiRNAs) account for 90-95% of the global small RNA population in all plant species. As their name suggests, rasiRNAs are derived from the various classes of repetitive DNA that constitute more than 95% of the entire nuclear genome sequence of a plant. The rasiRNAs keep the majority of the repetitive DNA in an inactive state. State; (1) the DNA-dependent RNA polymerase(s) involved in rasiRNA precursor transcript transcription; (2) whether rasiRNA precursors are molecules of perfectly or imperfectly...

Which of these are involved during the direct synthesis of a protein? a. mRNA, small ribosomal...

Which of these are involved during the direct synthesis of a protein? a. mRNA, small ribosomal subunit, amino acid b. tRNA, large ribosomal subunit c. RNA polymerase, transcription factors d. a and b e. all of these During protein translation, the codon on the mRNA matches to the complementary ____ . codon on the amino acid triplet on the DNA anticodon on the tRNA slot in the ribosome trio on the polypeptide During the electron transport chain, each protein is...

1. why is wine and beer complementary goods? explain. 2. is spirit and wine complementary goods...

1. why is wine and beer complementary goods? explain. 2. is spirit and wine complementary goods or substitutes? explain

5. Ser, Thr, and Tyr are well known targets for post-translational phosphorylation. A lesser known target...

5. Ser, Thr, and Tyr are well known targets for post-translational phosphorylation. A lesser known target is His [Kee and Muir, ACS Chem. Biol., 2012, 7 (1), pp 44–51], which can be phosphorylated at either the N-1 or N-3 positions of the imidazole group. One hindrance in studying this phosphorylation is its chemical lability, especially at low pH. Nevertheless, His phosphorylation is now recognized as an important signaling mechanism in prokaryotes and lower eukaryotes, and is being associated with mammalian...

1. Gifblaar is a small South African shrub and one of the most poisonous plants known...

1. Gifblaar is a small South African shrub and one of the most poisonous plants known because it contains fluoroacetic acid (FCH2COOH), which has a pKa of 2.59. Calculate the concentration of fluoroacetic acid in a solution that has the same pH as a 0.00745 M solution of HCl. 2. The leaves of the rhubarb plant contain high concentrations of diprotic oxalic acid (HOOCCOOH) and must be removed before the stems are used to make rhubarb pie. If pKa1 =...

Subjects