Question

In: Chemistry

indicate all the species, in proper sequence, to which the copper in the powder is transformed...

indicate all the species, in proper sequence, to which the copper in the powder is transformed during the course of the synthesis of CuCl

Solutions

Expert Solution

Copper exist as Cu(I), Cu(II) and Cu(III) which is rare. Cu (II) is most stable, Cu(III) is rare and Cu(I) is unstable and it is relatively sensitive to oxidation by moist air. The relative stabilities of each oxidation state depend on the nature of ligands and anions as well as the nature of the solvent medium.

In this experiment of preparing CuCl from CuCl2 atmost care should be taken because it is highly unstable in air or easily affected by moisture are often handled inside an inert atmosphere glovebox or glovebag, or in some cases a vacuum line.

Only those metals whose standard reduction potentials are lower than that of hydrogen react with non-oxidising acids like HCl and dil.H2SO4, and displace hydrogen from acids. since copper has higher reduction  potential (more positive) than hydrogen, and it does not react with HCl acid.

So in the process of making CuCl followings steps are followed,

1. 2Cu + O2 --> 2CuO

2. CuO(s) + 2 HCl(aq) → CuCl2(aq) + H2O(l)

3. In the 3rd step Sodium sulfite solution is added slowly to the Cu(II) chloride solution. Sodium sulfite solution act as reducing agent. reaction can be written as follows,

2Cu2+ + 2Cl- + SO32- + H2O --> 2CuCl + SO42- + 2H+

The Cu+ will immediately react with the available chloride ion to produce insoluble CuCl. And overall reaction can be written as follows,

2CuCl2(aq) + Na2SO3(aq) + H2O --> 2CuCl(s) + Na2SO4(aq) + 2HCl(aq)

now from above knowledge we can write species of copper transformed during course of reaction as

Cu(s)0--> Cu2+ --> Cu2+ --> Cu+


Related Solutions

A process in which light straight chain paraffins are transformed with proper catalyst into branched chains...
A process in which light straight chain paraffins are transformed with proper catalyst into branched chains with the same carbon number and high- octane numbers a. Write the name of the process and briefly explain. b. Draw and explain the above process.
Which of the following depicts the proper sequence of steps in the accounting cycle?
Which of the following depicts the proper sequence of steps in the accounting cycle? a. Journalize the transactions, analyze business transactions, prepare a trial balance b. Prepare a trial balance, prepare financial statements, prepare adjusting entries c. Journalize the transactions, analyze business transactions, prepare a trial balance d. Prepare a trial balance, prepare adjusting entries, prepare financial statements
On the sequence below: 1. Indicate the direction of transcription 2. Indicate which is the coding...
On the sequence below: 1. Indicate the direction of transcription 2. Indicate which is the coding strand and which one is the template for the transcription 3. Write down the mRNA 4. Write down the protein clearly indicating the first codon on the mRNA(hint: find the Kozak sequence RCCAUGG to identify the first codon) 5. Introduce a nonsense mutation 3' AGTCGACTGGCATCAGACTACGCTGTGACTGATACGCGTTTTATTGGATCGCACCGCATACAGGGCCCCGGTACCGTCCAAAACT CCCGAGTAGTCAGATGTCAGCAGCGAAATATACGG 5' 5'TCAGCTGACCGTAGTCTGATGCGACACTGACTATGCGCAAAATAACCTAGCGTGGCGTATGTCCCGGGGCCATGGCAGGTTTTGAGGGCTCATCAGTCTACAGT CGTCGCTTTATATGCC 3'
If a piece of DNA has the sequence: ATGCCG, which of the following would indicate a...
If a piece of DNA has the sequence: ATGCCG, which of the following would indicate a frameshift insertion mutation? ATGCCG ATGGCG TACGGC ATGAACCG
Predict the symmetry species of the vibrational modes of the following molecules and indicate which are...
Predict the symmetry species of the vibrational modes of the following molecules and indicate which are IR and Raman active, please show your work. Identify the point group. a. NH3 b. ClF3 (T-shaped) c. PtCl2L2 (cis and trans) d. ML5 (square pyrimidyl) e. ML6 (octahedral)
Indicate which of the amino acid residues in the following peptide sequence contains a group that...
Indicate which of the amino acid residues in the following peptide sequence contains a group that has a negative charge for its most likely charge state at pH 4. Met-Tyr-Ile-Trp-Gln-Val-Cys-Pro-Lys
Which of the following statements about invasive species is true? -All invasive species were dispersed by...
Which of the following statements about invasive species is true? -All invasive species were dispersed by humans intentionally. -All species' introductions are harmless. -Invasive species are a problem for terrestrial environments, while their impacts are often limited in aquatic environments. -Invasive species outcompete native species, often changing their habitats.
Which species is an intermediate? Which species is a catalyst?
Which species is an intermediate? Which species is a catalyst?
Write the procedure for using Stipites Laminaria drug. Indicate the species names from which drug was...
Write the procedure for using Stipites Laminaria drug. Indicate the species names from which drug was obtained.
Describe what is meant by the term “greenhouse effect”. Indicate which species make the greatest contribution...
Describe what is meant by the term “greenhouse effect”. Indicate which species make the greatest contribution and describe their natural and manmade sources. Explain why the major components of air are ineffective greenhouse gases.
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT