Question

in C++, please show step by step with simple codes. thank you

An application from Biology

The only built-in function you can use is length.

1. As a starting point, write a piece of pseudocode for a function that finds a substring of a string. Your

function should take as input the string, the starting point of the desired substring, and the length of the desired substring. For example, substring(“abracadabra”, 3, 5) should return “acada”.

2. Turn your pseudocode from 1 into C++ code. Run your code with several outputs to be sure it’s right.

3. We may wish to look for occurrences of specific protein sequences (that correspond to certain traits) in a strand of DNA. For instance, if you were looking for the protein sequence "AATG" in the DNA strand "ATGCAGAAAGCTACGATCAATGATCGATC AATGGAT", you would find that it starts at index 18. Note that there is more than one match, but we’ve found the starting index of the first one.

Write a piece of pseudocode, using your function from 1 and 2, that finds the index of the start of the the first match of a given string protein within the string dna. In our example above, protein would be “AATG” and dna would be "ATGCAGAAAGCTACGATCAATGATCGATC AATGGAT".

4. Turn your pseudocode from 3 into C++ code. Run your code with several outputs to be sure it’s right.

Answer 1

Answer 1:

Pseudocode substring(string inStr, int start, int size)

1. len <- inStr.length()

2. j <- 0

3. for i <- start to start+size

i. result[j] = inStr[i]

ii. j++, i++

4. result[j] <- '\0'

5. return result

Answer 2:

Code:

Code as text:

#include <iostream>

#include <string>

using namespace std;

// function to find substring of a string

string substring(string inStr, int start, int size) {

int len = inStr.length();

string result(size, ' '); // variable for result

int j = 0;

// loop from start to string size to get substr

for (int i = start; i < start + size; i++) {

result[j] = inStr[i];

j++;

}

result[j] = '\0';

return result; // return the substr

}

int main() {

cout << "Testing substring function.\n";

cout << substring("abracadabra", 3, 5) << endl;

cout << substring("asdfghjkl", 2, 6) << endl;

cout << substring("ATGCAGAAAGCTACGATCAATGATCGATC", 6, 4) << endl;

}

Sample Run:

Answer 3:

Pseudocode for search(string inStr, string s)

1. for i <- 0 till i < inStr.length()

i. subStr <- substring(inStr, i, s.length())

ii. check if subString is equal to search string

a. return index i

iii. end if

2. end for

3. return -1 i.e string not found

Answer 4:

Code:

Code as text:

#include <iostream>

#include <string>

using namespace std;

// function to find substring of a string

string substring(string inStr, int start, int size) {

int len = inStr.length();

string result(size, ' '); // variable for result

int j = 0;

// loop from start to string size to get substr

for (int i = start; i < start + size; i++) {

result[j] = inStr[i];

j++;

}

result[j] = '\0';

return result; // return the substr

}

/* function to find index of the start of the the first match of a given string protein within the string dna */

int search(string inStr, string s) {

for (int i = 0; i < inStr.length(); i++) {

string subStr = substring(inStr, i, s.length()); // get substring

// check if substring is equal to given string

if (subStr == s) {

return i; // return index if found

}

}

return -1; // return -1 if not found

}

int main() {

cout << "Testing search string function.\n";

cout << "Finding AATG in ATGCAGAAAGCTACGATCAATGATCGATC AATGGAT. \n";

int index = search("ATGCAGAAAGCTACGATCAATGATCGATC AATGGAT", "AATG");

if (index) {

cout << "Found at index: " << index;

} else {

cout << "Not found.";

}

}

Sample Run:

P.s. Ask any doubts in comments and don't forget to rate the answer