Question

In: Biology

Refer to the table of codons for the following question. A possible sequence of nucleotides in...

Refer to the table of codons for the following question.

A possible sequence of nucleotides in the template strand of DNA that would code for the polypeptide sequence phe-leu-ile-val would be _____. (Hint: TEMPLATE strand!)

5’ TTG-CTA-CAG-TAG 3’

5’ AUG-CTG-CAG-TAT 3’

3’ AAA-AAT-ATA-ACA 5’

3’ AAA-GAA-TAA-CAA 5’

Solutions

Expert Solution

Here, the correct option is 3' AAA GAA TAA CAA 5'

Explanation -

We have the amino acid sequence of the polypeptide chain i.e., PHE - LEU - ILE - VAL

The translation is the process in which the polypeptide chain is synthesized with mRNA as a template. The tRNA and ribosomes assist this process. The mRNA consists of the nitrogenous base sequence which acts as the template. A codon is a three-base group in the mRNA which is used in the translation process. These codons are used as a recognition site for the anticodons to bind to them and the tRNA (where the anticodons are already located on the other side) release the one corresponding amino acid (located on that tRNA molecule) to the growing polypeptide chain. This process goes on and a polypeptide chain is produced.

The three-letter codons are the base sequence and the code for a particular amino acid. It may possible that two or more codons codes for the same amino acid because we have 64 possible codons and only 20 amino acids.

So, the codons for the amino acids given are:

PHE: UUU, UUC

LEU: CUU, CUC, CUA, CUG

ILE: AUA, AUC, AUU

VAL: GUG, GUC, GUU, GUA

Now, Transcription is the process by which an RNA sequence is synthesised using DNA as a template. During transcription, the template strand of DNA acts as the template and mRNA is synthesised based on this template. This reaction is catalysed by DNA dependent RNA polymerase. The RNA sequence formed is complementary (adenine to uracil, thymine to adenine, guanine to cytosine and cytosine to guanine) to the template strand of DNA.

But, according to the question given the sequence of the mRNA will be

5' UUU CUU AUU GUU 3'

And the template strand DNA sequence will be: 3' AAA GAA TAA CAA 5'

Please hit on the like button if you are satisfied with the answer. Give comments for further clarification/assistance. Thanks! Have a good day.


Related Solutions

The following is a sequence of nucleotides in a DNA double helix that codes for a...
The following is a sequence of nucleotides in a DNA double helix that codes for a short polypeptide. The messenger RNA encoded by this DNA has both translational initiation and termination codons.                                     STRAND A: T T T A G T T A T C A A T C T T G G G T A G A A C                                     STRAND B: A A A T C A A T A G T T A G A A C...
The following sequence of 30 nucleotides corresponds to one of the two strands of a double...
The following sequence of 30 nucleotides corresponds to one of the two strands of a double stranded DNA: 5’ GATGTGATCAGACCGGGTGCACTCTAATCT 3’ a) This sequence has two perfect palindromes that consist of 6 base pairs each. What is the sequence of these two palindromes? b) Show both strands of your FIRST palindrome (indicate the 5’-3’ polarity) c) Show both strands of your SECOND palindrome (indicate the 5’-3’ polarity) Assume that the two palindromes are recognized by “6-cutter” restriction enzymes, and that...
What are nucleotides? How do nucleotides contribute to genes and chromosomes? Why is the trinucleotide sequence,...
What are nucleotides? How do nucleotides contribute to genes and chromosomes? Why is the trinucleotide sequence, CAG, important in Huntington Disease?
Refer to Table 3.1 to answer the following question Table 3.1 Individual Demand and Supply Schedules...
Refer to Table 3.1 to answer the following question Table 3.1 Individual Demand and Supply Schedules Quantity Demanded by Price Alejandro Ben Carl Market $8.00 8 4 2 _____ 6.00 12 4 4 _____ 4.00 20 4 6 _____ 2.00 22 4 6 _____ Quantity Supplied by Price Avery Brandon Cassandra $8.00 60 4 6 _____ $6.00 42 4 4 _____ $4.00 24 4 2 _____ $2.00 6 4 0 _____ In Table 3.1, the equilibrium market quantity is Multiple...
Refer to the expanded table below from review question
Additional information: This is pertaining to Microeconomics.Citrus College Refer to the expanded table below from review questionThousands or Bushels DemandedPrice per BushelThousands of Bushels SuppliedSurplus (+) or Shortage (-)85$3.4072-803.7073-754.0075-704.3077-654.6079-604.9081a. At what price is there neither a shortage nor a surplus? Fill in the surplus-shortage column and use it to confirm your answers. b. Graph the demand for wheat and the supply of wheat. Be sure to label the axes of your graph correctly. Label equilibrium price P and equilibrium quantity Q. c. How...
Refer to the information in the table that follows to answer the question that follows: The...
Refer to the information in the table that follows to answer the question that follows: The Agrinimia Macroeconomy Output (Income) Y Net Taxes T Consumption Spending (C = 100 + 0.9Yd) Savings S Planned Investment I Government Spending G 2400 100 2170 130 130 200 2800 100 2530 170 130 200 3000 100 2710 190 130 200 3200 100 2890 210 130 200 3400 100 3070 230 130 200 3600 100 3250 250 130 200 3800 100 3430 270 130...
Refer to the information in the table that follows to answer the question that follows: The...
Refer to the information in the table that follows to answer the question that follows: The Agrinimia Macroeconomy Output (Income) Y Net Taxes T Consumption Spending (C = 100 + 0.9Yd) Savings S Planned Investment I Government Spending G 2400 100 2170 130 130 200 2800 100 2530 170 130 200 3000 100 2710 190 130 200 3200 100 2890 210 130 200 3400 100 3070 230 130 200 3600 100 3250 250 130 200 3800 100 3430 270 130...
Make up YOUR OWN strand of dsDNA having five codons (15 nucleotides). You only have to...
Make up YOUR OWN strand of dsDNA having five codons (15 nucleotides). You only have to show the sequence of bases and not the sugar phosphate backbone. Replicate your DNA giving me all the proteins discussed in the course for replication to take place. Include the function of all proteins. Indicate the new and old strands (semi-conservative replication). Show the 5’ and 3’ ends of all strands. Tell me how many hydrogen bonds are between the bases holding the double...
Refer the previous question: The following table gives the common disorders, problems and complaints associated with...
Refer the previous question: The following table gives the common disorders, problems and complaints associated with each body system and its components relevant to the nursing care you might provide for your clients in the Australian health care system. Complete the following table with regard to its definition, pathophysiology, signs and impact of specific health procedures(in 10-20 words each). DISEASES AFFECTING THE CARDIOVASCULAR SYSTEM Angina pectoris Angina pectoris 11.1) Definition 11.2) Briefly outline the pathophysiology 11.3) List four specific signs...
Refer the previous question: The following table gives the common disorders, problems and complaints associated with...
Refer the previous question: The following table gives the common disorders, problems and complaints associated with each body system and its components relevant to the nursing care you might provide for your clients in the Australian health care system. Complete the following table with regard to its definition, pathophysiology, signs and impact of specific health procedures(in 10-20 words each). DISEASES AFFECTING THE RESPIRATORY SYSTEM Pneumonia Pneumonia 14.1) Definition 14.2) Briefly outline the pathophysiology 14.3) List four signs 14.4) Nurses should...
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT