Question

In: Biology

Is each of the following mutations a transition, a transversion, an addition, or a deletion? The...

Is each of the following mutations a transition, a transversion, an addition, or a deletion? The original DNA strand is 5′-GGACTAGATAC-3 ′ (Only the encoded DNA strand is shown.)

A. 5′-GAACTAGATAC-3 ′ B. 5′-GGACTAGAGAC-3 ′ C. 5′-GGACTAGTAC-3 ′ D. 5′-GGAGTAGATAC-3 ′

Solutions

Expert Solution

The original DNA sequence given is 5′-GGACTAGATAC-3 ′

A.

The mutated sequence is : 5′-GAACTAGATAC-3 ′

Here, the nucleotide at the second position in the original DNA sequence is 'G' and in the mutated sequence is 'A'. So, a purine nucleotide 'G' is changed into another purine nucleotide 'A'.

This type of mutation is called as 'transition' in which a purine (A, G) nucelotide is substituted by another purine nucleotide or a pyrimidine nucleotide (C,T) is changed into another pyrimidine.

B.

The given mutated DNA sequence is : 5′-GGACTAGAGAC-3 ′

Here, the Pyrimidine nucleotide 'T' at 9th position in the original sequence is changed to the purine nucleotide 'G' in the mutated sequence. This type of mutation is called 'transversion'. In transversion mutation, a pyrimidine nucleotide is substituted by a purine nucleotide or vice versa.

C.

The given mutated DNA sequence is : 5′-GGACTAGTAC-3′

It is a deletion mutation. The nucleotide 'A' at the 8th position of the original DNA got deleted to form this mutant DNA sequence.

D. The given mutated DNA sequence is : 5′-GGAGTAGATAC-3 ′

Here, in the mutated sequence purine nucleotide 'G' is present at the fourth position instead of the 'C' pyrimidine nucleotide as in the original sequence. This type of mutation is called as 'transversion'. In transversion mutation, a purine nucleotide is substituted by a pyrimidine nucleotide or vice versa.


Related Solutions

Using a DNA sequence as an example, illustrate and describe the listed mutations - deletion -...
Using a DNA sequence as an example, illustrate and describe the listed mutations - deletion - insertion - nonsense mutation - substitution - back mutation
1.Deletion of the KKXX sequence in the translocation would lead to it trafficking to? 2.Addition of...
1.Deletion of the KKXX sequence in the translocation would lead to it trafficking to? 2.Addition of a KDEL to a protein X that is normally secreted would lead to it being trafficked to? 3.Blocking clathrin-coat assembly would inhibit trafficking between which compartments? 4.A protein that is normally sent to the lysosome has all asparagine (single letter abbreviation N) residues replaced with lysine. What would happen to trafficking of this protein?
Describe each of the below mutations AND provide an example of each. Behavioral mutations Regulatory mutations...
Describe each of the below mutations AND provide an example of each. Behavioral mutations Regulatory mutations Lethal mutation Conditional mutation Neutral mutation
Deletion of Product Line St. Gallen American School is an international private elementary school. In addition...
Deletion of Product Line St. Gallen American School is an international private elementary school. In addition to regular classes, after-school care is provided between 3:00 pm and 6:00 pm at CHF 10 per child per hour. Financial results for the after-school care for a representative month are as follows: Revenue, 750 hours at CHF 10 per hour                                                                     CHF 7,500 Less            Teacher salaries                                                     CHF 5,300            Supplies                                                                           1,200            Depreciation                                                                   1,700            Sanitary engineering                                                         200            Other fixed costs                                                               400                                 ...
How does each of your mutations affect the amino acid sequences? Are the mutations missense mutations,...
How does each of your mutations affect the amino acid sequences? Are the mutations missense mutations, silent mutations or nonsense mutations? Point mutation? Frameshift-insertion? Frameshift-deletion The non mutated Sequence: AUG GAG GUC UUU AAG AGA CAU UUA GAU GUA GCC CUU AGU GAU GUU UAG Point Mutation: AUG GAC GUC UUC AAG AGC CAU UUA GAA GUA GCC CUU AGU GAU GUC UAG Translation: Met Asp Val Phe Lys Ser His Leu Glu Val Ala Leu Ser Asp Val Stop....
What is the likely effect of each of the following mutations of the trpL region on...
What is the likely effect of each of the following mutations of the trpL region on attenuation control of trp operon gene transcription? Explain your reasoning. a. Region 3 is deleted. b. Region 4 is deleted. c. The entire trpL region is deleted. d. The start (AUG) codon of the trpL polypeptide is deleted. e. Two nucleotides are inserted into the trpL region immediately after the polypeptide stop codon. f. Twenty nucleotides are inserted into the trpL region immediately after...
Exposure to various chemicals can cause DNA mutations. Sort the Phrases below as transition, Transversion, or...
Exposure to various chemicals can cause DNA mutations. Sort the Phrases below as transition, Transversion, or insertion/deletion mutations Transition Transversion Insertion/ Deletion 1) Replacement of A:T with C:G 2) Treatment with 5 bromouracil causes the replacement of A:T with G:C 3) Oxidative deamination via nitrous acid causes this type of mutation 4) Treatment with dimethyl sulfate causes this type of mutation 5) Replacement of G:C with A:T 6) the removal of one or more base pairs 7) treatment with proflavin...
For each of the following, determine the FOS and dn configuration for the transition metals. Be...
For each of the following, determine the FOS and dn configuration for the transition metals. Be sure to clearly show the FOS and/ or charges for all relevant ligands and species. A. Cr(OH2)3(OH)3 B. [Cr(NH3)6][Cr(CN)6] C. TiCl3 D. Cp2Hf(CO)2 E. Fe(CO)5
Two mutations complement each other. What can be said about this? a) The mutations are not...
Two mutations complement each other. What can be said about this? a) The mutations are not in essential genes. b) The mutations are epigenetic. c) The mutations affect the same gene. d) The mutations affect different genes. e) None of the above.
2. (6 pts) Speculate on the effects of each of the following mutations on the translation...
2. (6 pts) Speculate on the effects of each of the following mutations on the translation of the following mRNA. Specifically indicate whether any product would be made, and if so, if it would be altered in any way.  (GpppG is the 5’ cap) 5’GpppGUAACAUGGUCGGACCAUGAC(A)2003’ Mutation that removes the editing pocket from isoleucine-tRNA synthetase. Mutation that prevents GTP hydrolysis of eEF1-a. Mutation that prevents binding of GTP by eEF2.
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT