Question

In: Biology

Explain how splicing occurs by labeling the 5’ss, the 3’ss the branch point and then tell...

Explain how splicing occurs by labeling the 5’ss, the 3’ss the branch point and then tell me which snRNPs are used and where they play a part in the two transesterifications in splicing. You need to explain and show me the two transesterifications that happen in splicing.

Solutions

Expert Solution

RNA splicing is one of the forms of RNA processing, by which the the newly made RNA transcript is transformed into a mature messenger RNA.
During splicing, introns are removed and exons are joined together. splicing is carried out in a series of reactions which are catalyzed by the spliceosome, a complex of small nuclear ribonucleo proteins (snRNPs) for many eukaryotic introns.
A donor site, 5' end of the intron, a branch site, near the 3' end of the intron and an acceptor site, 3' end of the intron are required for splicing within introns.

The splice donor site includes an almost invariant sequence GU at the 5' end of the intron, within a larger, less highly conserved region. The splice acceptor site at the 3' end of the intron terminates the intron with an almost invariant AG sequence. Upstream (5'-ward) from the AG there is a region high in pyrimidines (C and U), or polypyrimidine tract. Further upstream from the polypyrimidine tract is the branchpoint, which includes an adenine nucleotide involved in lariat formation.
The consensus sequence for an intron is:
G-G-[cut]-G-U-R-A-G-U (donor site) ... intron sequence ... Y-U-R-A-C (branch sequence 20-50 nucleotides upstream of acceptor site) ... Y-rich-N-C-A-G-[cut]-G (acceptor site). the specific sequence of intronic splicing elements and the number of nucleotides between the branchpoint and the nearest 3’ acceptor site affect splice site selection. point mutations in the underlying DNA or errors during transcription can activate a cryptic splice site in part of the transcript that usually is not spliced.
a point mutation, which might otherwise affect only a single amino acid, can manifest as a deletion or truncation in the final protein.


Related Solutions

1. In eukaryotic mRNA splicing, which snRNP binds to the branch point A? A. U1 B....
1. In eukaryotic mRNA splicing, which snRNP binds to the branch point A? A. U1 B. U2 C. U3 D. U4 E. U5 F. U6 2. Transcription of protein coding genes in prokaryotes and eukaryotes differs in which way? A. The direction of synthesis of the RNA polynucleotide B. The requirement for a primer C. The requirement for the promoter sequence D. The requirement for a promoter sequence E. The requirement for excision of introns 3. During transcription from a...
Explain how splicing factor Slu7 would control alternative splicing of mRNA precursor?
Explain how splicing factor Slu7 would control alternative splicing of mRNA precursor?
During DNA replication, which of the following processes occurs in the 3' to 5' direction? explain...
During DNA replication, which of the following processes occurs in the 3' to 5' direction? explain Excision of RNA primers Proofreading by DNA polymerase Lagging strand DNA synthesis
9. If the following mutation occurs in COVID19 RNA 5’ GGGUACAUGGUAGCCCCCGUCGAGAAAACACCC…. 3’ to 5’ GGGUACAUGGUAGCCCCCGUCGCCCCGUAGAAAACACCC…. 3’,...
9. If the following mutation occurs in COVID19 RNA 5’ GGGUACAUGGUAGCCCCCGUCGAGAAAACACCC…. 3’ to 5’ GGGUACAUGGUAGCCCCCGUCGCCCCGUAGAAAACACCC…. 3’, what most likely would be the outcome of such a change in its sequence: A frameshift mutation effect A silent mutation effect No effect resulted from the mutation A nonsense mutation effect A missense mutation effect 10.To conduct molecular analyses of COVID19 RNA sequence, which of the following biotechnology should be used to amplify samples of RNA: RNA Recombinant Plasmid Duplication RNA Fingerprinting Replication...
Explain the following developmental periods. Tell us what occurs during Implantation Gastrulation Neurulation Name and explain...
Explain the following developmental periods. Tell us what occurs during Implantation Gastrulation Neurulation Name and explain the 3 parts of labor. Be sure to include that the placenta is composed of the __________ layer from the embryo and the mother’s __________________.
In 3-4 Paragraphs explain how you will appraise and manage the employee's performance. And tell me...
In 3-4 Paragraphs explain how you will appraise and manage the employee's performance. And tell me how and why you think you're my best candidate for Chief Executive Office
When external pressure decreases which occurs? 1) boiling point decreases 2) boiling point increases 3) temperature...
When external pressure decreases which occurs? 1) boiling point decreases 2) boiling point increases 3) temperature increases 4) liquid condense 5) none of these
Briefly explain how alternative patterns of RNA splicing give rise to multiple isoforms of proteins. Why...
Briefly explain how alternative patterns of RNA splicing give rise to multiple isoforms of proteins. Why is this an important form of post-transcriptional regulation?
3. Consider the following table SS DF MS F Among Treatments ? 5 1139.19   Error     223.49...
3. Consider the following table SS DF MS F Among Treatments ? 5 1139.19   Error     223.49 Total 8601.32 18 Step 1 of 8: Calculate the sum of squares among treatments. Please round your answer to two decimal places. Step 2 of 8: Calculate the sum of squares of experimental error. Please round your answer to two decimal places. Step 3 of 8: Calculate the degrees of freedom of experimental error. Step 4 of 8: Calculate the F-value. Please round your...
QUESTION 3 Explain the two different cultures of assessment. [5] QUESTION 4 Point out the relationship...
QUESTION 3 Explain the two different cultures of assessment. [5] QUESTION 4 Point out the relationship between validity and reliability in the following statement: “an assessment test that lacks reliability must also lack validity.”[5] QUESTION 5 How did the positivist view knowledge and the role of the educator? [10] QUESTION 6 Compare the attributes of traditional and performance-based assessment. [18] QUESTION 7 Which questions are relevant for teachers to ask if they want to do self-evaluation on quality learning? [12]
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT