6. Fill in the sequences that would be used to make virions for the following virus...

6. Fill in the sequences that would be used to make virions for the following virus types. HIV: (+)mRNA: GUA GGC cDNA1: cDNA2: Final mRNA: HINT: Use cDNA1 Influenza: (-)mRNA: GUA CCG Final mRNA: Coronavirus: (+) mRNA: AUG CCC Final mRNA:

Solutions

Expert Solution

The sequences that would be used to make virions for the viruses are from mRNA which codes the cDNA and then the final mRNA is coded. Hence the viral mRNA will be used as template for cDNA1 and the cDNA1 will be the template for cDNA2 and also for the mRNA.Hence for the viruses

HIV: (+)mRNA sequence = GUA GGC

cDNA1 sequence = CAT CCG

cDNA2 sequence = GTA GGC

Final mRNA = CAU CCG (complementary to cDNA2) (-)mRNA

GUA GGC (complementary to cDNA1) (+)mRNA

Influenza virus: (-)mRNA = GUA CCG

cDNA1= CAT GGC

cDNA2 = GTA CCG

final mRNA= CAU GGC (complementary to cDNA2) (+)mRNA

GUA CCG (complementary to cDNA1) (-)mRNA

Coronavirus: (+) mRNA: AUG CCC

cDNA1= TAC GGG

cDNA2= ATG CCC

final mRNA = UAC GGG (complementary to cDNA2) (-)mRNA

AUG CCC (complementary to cDNA1) (+)mRNA

If you have any query kindly comment before giving thumbs up. Thank you.

gladiator answered 1 year ago

Next > < Previous

Related Solutions

For optimal alignment of 2 sequences, fill in the blanks for the following dot plot:

For optimal alignment of 2 sequences, fill in the blanks for the following dot plot:a) A diagonal move indicates 2 residues are___b) A vertical move indicates a ___c) A horizontal move indicates an ___

6. Use the periodic chart to fill in all the missing items so as to make...

6. Use the periodic chart to fill in all the missing items so as to make the nuclear decays complete. I.e., specify completely (i.e. including subscripts and superscripts) Z and X in each of the two separate reactions below. 92^238U + 0^1 n --> 57^140La + Z + 2 0^1n 88^226Ra --> X + 2^4 He

The steps to creating an information security plan would be in which of the following sequences?...

The steps to creating an information security plan would be in which of the following sequences? Identify threats, identify risks, design controls, incorporate controls into an enterprise-wide plan, Set forth policies Set forth policy, design controls, identify risks, identify threats, incorporate controls into an enterprise-wide plan

6. The following sequences are mutations of the template sequence in question 1. For each mutated...

6. The following sequences are mutations of the template sequence in question 1. For each mutated sequence, indicate the new amino acid sequence produced and the type of mutation that is the end result in the amino acid (frameshift, Missense, nonsense, silent) as well as the type of mutation that occurred in the DNA sequence (substitution, addition, deletion) Template sequence question 1: 3’ TACCCTGGTGGTTTGCGGACT 5’ a. 3’ TAC CCG GTG GTT TGC GGACT 5’ b. 3’ TAC ACT GGTGGTTTGCGGACT 5’...

The following program is used to sum arrays. Fill in blanks of the following program to...

The following program is used to sum arrays. Fill in blanks of the following program to complete the program and make the output is: s = 150. #include <iostream.h> class Arr { int *a,n; public: Arr():a(0),n(0){} Arr(int *aa, int nn) {n=nn; a=new int [n]; for(int i=0;i<nn;i++) *(a+i)=*(aa+i); } ~Arr(){delete a;} _____________ {return *(a+i);} }; void main() { int b [5]={10,20,30,40,50}; Arr a1(b,5); int i=0,s=0; _____________ s+=a1.GetValue(i); cout<<"s="<<s<<endl; }

Describe a strategy for how you would make a vaccine against a virus using genetic engineering...

Describe a strategy for how you would make a vaccine against a virus using genetic engineering and protein expression and purification system (i.e. from gene cloning to protein purification).

Fill in the blanks to make the following statements correct. a. The equation for actual national...

Fill in the blanks to make the following statements correct. a. The equation for actual national income from the expenditure side is written as: GDP = ___________________. A. Ca + Ia + Ga (Xa - IMa) B. a + bY C. C + I + G + (X - IM)

Fill in the blank with “all”, “no”, or “some” to make the following statements true. Note...

Fill in the blank with “all”, “no”, or “some” to make the following statements true. Note that “some” means one or more instances, but not all. • If your answer is “all,” then give a brief explanation as to why. • If your answer is “no,” then give an example and a brief explanation as to why. • If your answer is “some,” then give two specific examples that illustrate why your answer it not “all” or “no.” Be sure...

Fill in the blanks to make the following statements correct. a. In the long run, total...

Fill in the blanks to make the following statements correct. a. In the long run, total output is determined only by ▼ (potential output or actual output). In the long run, aggregate demand determines the ▼ (price level or output level). b. Permanent increases in real GDP are possible only if ▼ (potential output or actual output) is increasing. c. Suppose illiteracy in Canada were eliminated, and the school dropout rate was reduced to zero. The effect would be a...

Short Answer1 Describe what a virus is and the macromolecules that make up a virus. Include...

Short Answer1 Describe what a virus is and the macromolecules that make up a virus. Include what all viruses have in common and what are some unique features of specific viruses. Describe the structure of the coronavirus, specifically describing which macromolecules are present.

Subjects