Question

In: Biology

1. uncoating or viral nucleic acid a) does not occur in bacteriophage multiplication b) occurs before...

1. uncoating or viral nucleic acid

a) does not occur in bacteriophage multiplication

b) occurs before replication

c) involves enzymatic destruction of the cas...

2. satellite viruses are?

a) also called viroids

b) significants photogens of plants

c) dependent in other viruses for replication

d) the cause of spongiform encephalopathy

3. atypical viruses without a capsid are called?

a) caples viruses

b) helical viruses

c) complex viruses

d) viroids

Expert Solution

Answer of question no 1.

The correct option is b.

Uncoating of viral nucleic acid is must for replication of viral nucleic acid. Entry inside a host cell is must for viral replication. The virus uses the host's cellular machinery for expressing it's gene.The uncoating of viral particle happens either before entry (bacteriophages) or happens inside the cell. When uncoating happens inside the cell then cellular enzymes like lysozymes help in degrading the viral coat. Once nucleic is free from viral coat, it can replicate with the help of different enzymes.

Option A is incorrect- Uncoating also happens during bacteriophage replication. Hence, this option is incorrect,

Option C is incomplete- The given statement is not properly written, If the last word is capsid. then this option can also be correct,

Answer of question 2

The correct option is C

The satellite viruses are those viruses which can not replicate without help of another virus in the cell. Because of this reason. it is called sub viral particle. Satellite viruses can not code for their own structural capsid protein. The helper viruses code for coat proteins of satellite viruses. Therefore. satellite viruses can not replicate on their own.

Option A is incorrect- Viroids are made up of RNA only. They are different from satellite viruses.

Option B is not most appropriate- This option is also correct at some extent. If more than one options are correct then it can also be considered as correct one. Although , mostly satellite viruses are pathogens of plant but they also infect arthropods and mammals.

Option D is incorrect- Spongiform encephalopathy is caused by Prions. It is not caused by satellite viruses.

Answer of question 3

The correct option is d

Viroids do not contain any capsid or coating. Viroids are one of the smallest pathogen. They are made up of small, single stranded RNA only. No protein or capsid is present in case of viroids. They are pathogenic to plants mainly.

For example - Cadang cadang viroid (coconot) and potato spindle tuber viroid,

All options are incorrect- as all of them contain capsid.

gladiator answered 4 months ago

Hepatitis B Virus: 1. Describe the viral architecture 2. Nucleic acid composition 3. Enveloped or non-enveloped?...

Hepatitis B Virus: 1. Describe the viral architecture 2. Nucleic acid composition 3. Enveloped or non-enveloped? 4. Host(s)? How does the virus gain entrance to host? 5. Mode of transmission(s)? 6. Organ System(s) affected? 7. Symptoms of viral disease. 8. Treatments? 9. Acute or persistent infection and why?

Sort the parts of a nucleic acid according to whether each occurs exclusively in DNA, exclusively in RNA, or in both types of nucleic acid.

where does fatty acid oxidation occur?"

1. (a) What is address resolution? (b) Where does it occur?

1. How do viral oncogenes occur? 2. How do viral oncogenes cause cancer (what is the...

1. How do viral oncogenes occur? 2. How do viral oncogenes cause cancer (what is the general mechanism)? Please do not copy and paste an incorrect answer. Thumbs down for such atrocity.

2) Why do most insertions of the viral genome occur in the exon 1 and intron...

2) Why do most insertions of the viral genome occur in the exon 1 and intron 1 region? 3) If an insertion of the viral genome occur in the exon 2 or exon 3, does it convert the myc gene into an oncogene? If yes, how does it work? If not, why not?

Summary Questions What major event happens just before prophase I but does not occur before prophase...

Summary Questions What major event happens just before prophase I but does not occur before prophase II? How do the chromosomes of an anaphase cell of mitosis differ from those of an anaphase cell of meiosis I? Which results in the change in chromosome number from diploid to haploid, meiosis I or meiosis II? What is crossing over? Why is it significant? Which process, mitosis or meiosis, produces daughter cells which are genetically identical to the parent cell? Explain.

1.What is the name for the covalent bonds that create the Nucleic Acid backbone? 2.Define Complementarity...

1.What is the name for the covalent bonds that create the Nucleic Acid backbone? 2.Define Complementarity as it is used in nucleic acid base pairing and explain how complimentary base pairing is the basis for making faithful copies of DNA from DNA templates and RNA from DNA templates.

1. tRNA aminoacylation a. What is aminoacylation? Where on the tRNA does it occur? b. Why...

1. tRNA aminoacylation a. What is aminoacylation? Where on the tRNA does it occur? b. Why is ATP required for aminoacylation? Why is the hydrolysis of PPi generated during aminoacylation important? c. What is the significance of the high-transfer potential of the ester bond created during tRNA aminoacylation? d. Why is the specificity of aminoacyl-tRNA synthetases important? How do these enzymes ensure their specificity? e. Are you familiar enough with amino acid side chains to answer questions about aminoacyl-tRNA synthetase...

Which single-stranded nucleic acid could form a hairpin structure? Select one: a. 5’ TTTGCGATACTCATCGCATT 3’ b....

Which single-stranded nucleic acid could form a hairpin structure? Select one: a. 5’ TTTGCGATACTCATCGCATT 3’ b. 5’ TTTGCGATACTCACACTATT 3’ c. 5’ TTTGCGATACTCTGCGATTT 3’ d. All of the sequences above could form a hairpin loop. e. None of these sequences could form a hairpin loop.