Which of the following represents the normal sequence in which the below budgets are prepared?

Sales Budget, Budgeted Income Statement, Budgeted Balance Sheet
Budgeted Balance Sheet, Sales Budget, Budgeted Income Statement
Budgeted Income Statement, Sales Budget, Budgeted Balance Sheet
Sales Budget, Budgeted Balance Sheet, Budgeted Income Statement

Expert Solution

Answer : Option : A : Sales Budget , Budgeted Income statement, Budgeted Balance sheet.

Explanation : In budget preparation sales are estimated first , then with the help sales budget income statement and balance sheet are prepared, without preparing sales budget income statement and budgeted balance sheet can't be prepared.

Reasons for other options incorrect:

Option B : Budgeted Balance sheet is prepared at last not at the beginning.

Option C : Budgeted Income statement is prepared after preparing sales budget not at the beginning.

Option D : After budgeted sales budget income statement is prepared not budgeted balance sheet.

ekkarill92 answered 2 years ago

The sequence below represents the DNA sequence of the polylinker (also called the multiple cloning site)...

The sequence below represents the DNA sequence of the polylinker (also called the multiple cloning site) on a plasmid, with the dots (...) on either side representing the continuing DNA on either side of the polylinker .............5' CACTTAAGCCTGCAGCGTTAGCGT 3'......... ..............3' GTGAATTCGGACGTCGCAATCGCA 5'.......... The plasmid is cut with the restriction endonuclease Pst1, which recognizes the following sequence: -------- -- -5' CTGCAG 3' and which cuts between the A and the G nucleotides. A. After cutting the plasmid with Pst1, how many...

23. Which one of the following items is the last schedule to be prepared in the normal

23. Which one of the following items is the last schedule to be prepared in the normal budget preparation process? a. Selling and Administrative Expense budget. b. Cost of goods sold budget. c. Manufacturing overhead budget. d. Cash Budget. 24. Which one of the following organizational policies is most likely to result in undesirable managerial behavior? a. Joe Walk, the chief executive officer of Eagle Rock Brewery, wrote a memorandum to his executives stating, "Operating plans are contracts, and they should be met without fail." b. The budgeting process at Madsen...

The sequence below represents the coding DNA strand of the start of a gene, including part...

The sequence below represents the coding DNA strand of the start of a gene, including part of the 5' untranslated region. (5')...TCGGAAGGAGGTAGCGGCAATGGGGAAAAGTATTGCTT...(3') In studying variants of this gene in disease, a nucleotide mutation of A→T was detected in the first base of the third codon. What effect would this mutation have? (When considering your answer, assume standard initiation of translation is numbered as codon 1.) Select one: a. Terminates translation b. No effect c. Disrupts ionic interactions at physiological pH...

Multiple Choice: The nucleotide sequence below represents a gene along the length of part of a...

Multiple Choice: The nucleotide sequence below represents a gene along the length of part of a chromosome. Below the DNA is a pool of tRNA’s with their attached amino acids: the three nucleotides represent the anticodon and the number above each anticodon symbolizes a particular amino acid attached to that tRNA. Using your knowledge of the steps involved in how genes code for proteins, determine which of the amino acid (number) sequences below would correspond with the expected polypeptide chain...

Which of the following correctly lists the trial balance worksheet sequence? a.)1. Trial balance is prepared....

Which of the following correctly lists the trial balance worksheet sequence? a.)1. Trial balance is prepared. 2. Adjusting entries are made. 3. Income statement is prepared on the worksheet. 4. Balance sheet is prepared on the worksheet. 5. Closing entries are made to close out temporary accounts and determine net income or net loss for the period. 6. Adjusted trial balance is prepared. b.)1. Trial balance is prepared. 2. Adjusting entries are made. ...

2.) Consider the following RNA sequence, which represents the beginning of an open reading frame: 5’-AUGGGACUAGAUACC-3’....

2.) Consider the following RNA sequence, which represents the beginning of an open reading frame: 5’-AUGGGACUAGAUACC-3’. Examine each of the sequences below, describe the change to the sequence, and state whether it represents a silent, missense, nonsense, or frameshift mutation. If frameshift, be sure to include the consequences of the frameshift (nonsense or massive missense). Use the codon table. a) 5’-AUGGGUCUAGAUACC-3’ b) 5’-AUGCGACUAGAUACC-3’ c) 5’-AUGGGACUAGUUACC-3’ d) 5’AUGGGACUAAGAUACC-3’ 3. Using a couple of sentences each, describe the function of each of...

Which of the following represents an example of a population?

Which of the following represents an example of a population?all of the mammals living in the region of Boulder, Coloradothe gray squirrels and fox squirrels living in Springfield, Illinoisthe eastern gray squirrels that live in New York City's Central Parkthe red foxes found east of the Mississippi River in the United States

The following sequence is a fragment from the normal version of the Social B gene of...

The following sequence is a fragment from the normal version of the Social B gene of Solenopsis daguerrei ants. You may need to use the codon table provided. DNA SocialB: 5’- ATG TCG GTA GCA TGT GTC TGC-3’ A transition mutation in the sequence results in a change in the 3rd amino acid of the polypeptide chain: Alanine is produced. The DNA sequence with the mutation (the one used to name the SNP 5’ to 3’) is_______. Options - a....

I. Use the DNA sequence below, which encodes a prokaryotic gene to answer the following questions....

I. Use the DNA sequence below, which encodes a prokaryotic gene to answer the following questions. 1 ATGAGGAGTT 11 GACACACAAG 21 AGGAGGTAGC 31 AGTATGGGTA 41 TAATCTAATG 51 CGTAATTGAG 61 GAGGTAGTTG 71 ACGTATGAAT 81 AGTTAACGTA 91 CGGGGGGGAA 101 ACCCCCCCTT 111 TTTTTTTTTC 121 GAGCAATAAA 131 AGGGTTACAG 141 ATTGCATGCT b) What region of this prokaryotic DNA sequence will be transcribed into mRNA? Circle one. 1-131 71-119 74-149 54-119 c) What will the sequence be for the protein translated from this mRNA? d) Where...

Which of the following represents the expenditure multiplier? A. it is the factor by which a...

Which of the following represents the expenditure multiplier? A. it is the factor by which a change in autonomous spending is multiplied to obtain the change in income B. It is the ratio of income to consumption C. It is the factor by which income is multiplied to obtain the change in aggregate spending D. It is the ratio of the change in income divided by the change in consumption

Question