Question

Biologists use a sequence of the letters A, C, T, and G to model a genome. A gene is a substring of a genome that starts after a triplet ATG and ends before a triplet TAG, TAA, or TGA. Furthermore, the length of a gene string is a multiple of 3, and the gene does not contain any of the triplets ATG, TAG, TAA, or TGA. Write a program that prompts the user to enter a genome and displays all genes in the genome. If no gene is found in the input sequence, display “no gene is found”. use a for loop and string to create this program.

Here are the sample runs:

Enter a genome string:

TTATGTTTTAAGGATGGGGCGTTAGTT

TTT

GGGCGT

Enter a genome string:

TGTGTGTATAT

no gene is found

Answer 1

package MainPackage;

import java.util.Scanner;

public class GenomeString {
   public static void main(String[] args) {
       String result = "";
       System.out.println("Enter a Genome string:");
       Scanner s = new Scanner(System.in);
       String genome = s.next();
       int i=0,j=0;
       /*For and while both do the same functionality but here iam using increment of counter variable in middle of loop so I used while */
       while(i <= genome.length()-3) {
           //Iam iterating through all the letters and checking whether three letters starting with the letter matches "ATG"
           if(genome.substring(i, i+3).equals("ATG")) {
               // If three letters match we need start checking for the ending triplet of genome after third letter so added 3
               i = j = i+3;
               //Iterating through the remaining word for ending triplet
               while(j <= genome.length()-3) {
                   /* As the the gene cannot contain "ATG", if there is ATG I will start checking for ending triplet from the second "ATG" */
                   if(genome.substring(j, j+3).equals("ATG")) {
                       i = j = j+3;
                   }
                   if(genome.substring(j, j+3).equals("TAG") || genome.substring(j, j+3).equals("TAA") || genome.substring(j, j+3).equals("TGA")) {
                       result = genome.substring(i,j);
                       System.out.println(result);
                       break;
                   }
                   j++;
               }
               continue;
           }
           i++;
       }
       if(result == "") {
           System.out.println("No gene found");
       }
   }
}

Sample Outputs:-