Question

In: Computer Science

In the passage below, which punctuation marks are used incorrectly? The quality of these determinants stems...

In the passage below, which punctuation marks are used incorrectly?

The quality of these determinants stems from national institutions. According to Lee (1999), institutional development, formal or informal, drives growth. It aligns incentives for private and social returns, affecting trade and growth-enhancing policy. Others have examined long-term effects, those of colonialism, which include: impacts on current institutional settings and economic growth. (Zhang 2001). Despite instructional development’s benefits, developing countries enjoy institutionally-embedded norms. We ask; are these determinants diverse?

Choose as many as you like

A: Comma

B: Colon

C: Semicolon

D: Hyphen

E: Period

F: Question mark

G: Apostrophe

Solutions

Expert Solution

Passage:

The quality of these determinants stems from national institutions. According to Lee (1999), institutional development, formal or informal, drives growth. It aligns incentives for private and social returns, affecting trade and growth-enhancing policy. Others have examined long-term effects, those of colonialism, which include: impacts on current institutional settings and economic growth. (Zhang 2001). Despite instructional development’s benefits, developing countries enjoy institutionally-embedded norms. We ask; are these determinants diverse?

Incorrect: Comma

It aligns incentives for private and social returns, affecting trade and growth-enhancing policy.

Correct:

It aligns incentives for private and social returns affecting trade and growth-enhancing policy.

Incorrect: Colon

Others have examined long-term effects, those of colonialism, which include: impacts on current institutional settings and economic growth.

Correct:

Others have examined long-term effects, those of colonialism, which include impacts on current institutional settings and economic growth.

Incorrect: Semicolon

We ask; are these determinants diverse?

Correct:

We ask, are these determinants diverse?

venereology answered 3 weeks ago
Next > < Previous

Related Solutions

Revise the following sentences in which the subject and object pronouns are used incorrectly. Write a...
Revise the following sentences in which the subject and object pronouns are used incorrectly. Write a “C” for each sentence that is correct 1. They and I met while on vacation in Mexico 2. Between you and I, I do not think Jeffrey will win the election 3. The cooking instructor taught her and me a lot.
Which punctuation marks do you think are most difficult to use correctly? Why? What might you...
Which punctuation marks do you think are most difficult to use correctly? Why? What might you do to help remember the rules for these punctuation marks or to make effective choices about these punctuation marks? United States answer only
Based on the review notes presented below, select those items, which Charles has correctly (and incorrectly)...
Based on the review notes presented below, select those items, which Charles has correctly (and incorrectly) identified as deficiencies in the report by clicking the appropriate options. Select an answer for every instance. REVIEW NOTES: Charles, CPA, audited the consolidated financial statements of Right Industries and all but two of its subsidiaries of the years ended December 31, Year 1, and December 31, Year 2. Tyler is the staff accountant assigned to the Right engagement. Charles expressed a qualified opinion...
can anyone summarize for me the below passage and to add some information which You got...
can anyone summarize for me the below passage and to add some information which You got from the below passage Sense of Coherence Antonovsky took a very different tact in health promotion and disease prevention. Antonovsky's central premise is that it is more useful to study health than to study disease. He referred to this method of study as salutogenesis, the beginnings of health. Salutogenesis defines health in terms of a continuum of ease to dis-ease and with the conditions...
You are a marketing analyst at a major US clothing retailer. Which three demand determinants (below)...
You are a marketing analyst at a major US clothing retailer. Which three demand determinants (below) are the most important in forecasting sales? Justify your choices. 1.            Consumers' tastes and preferences 2.            The number of buyers in the market 3.            Consumers' income 4.            The price of the related commodities 5.            Consumer expectations
Consider the market for minivans. For each of the events listed below, identify which of the determinants of demand or supply are affected.
Consider the market for minivans. For each of the events listed below, identify which of the determinants of demand or supply are affected. Also indicate whether demand or supply is increased or decreased. Then show the effect on the price and quantity of minivans.a. People decide to have more children.b. A strike by steelworkers raises steel prices.c. Engineers develop new automated machinery for the production of minivans.d. The price of SUVs rises.e. A stock market crash lowers people’s wealth.
The table below summarizes nested multiple regression models used to predict a person’s quality of life...
The table below summarizes nested multiple regression models used to predict a person’s quality of life score. Model 1 Model 2 Model 3 est. sig. est. sig. est. sig. intercept 16.68 <.001 9.16 <.001   7.57 <.001 size of social network   0.59 0.027 0.44 0.076   0.43 0.059 college degree — 3.73 0.014   3.87 0.030 time (yrs) at current job — —   0.91 0.046 # of siblings — — –0.68 0.146 R2R2 3.65% 8.01% 9.60% ΔR2ΔR2 3.65% 4.36% 1.59% FF (for ΔR2ΔR2)...
During the 1990s, the management "craze" was TQM (Total Quality Management) in which workers used the...
During the 1990s, the management "craze" was TQM (Total Quality Management) in which workers used the term "customer" to describe anyone who was receiving their services, not just real customers that were purchasing goods and services from the firm. Government agencies also joined in. For example, IRS workers were told to call taxpayers with whom they dealt "customers," and when I was doing some work at the Tennessee Valley Authority, we were to call people in other departments that ordered...
Question Three (20 Marks) a)         For each of the companies described below explain which one you...
Question Three a)         For each of the companies described below explain which one you would expect to have a medium, high or low dividend payout ratio. A company with a large proportion of inside ownership, all of whom are high income individuals.                                                                             A growth company with an abundance of good investment opportunities.                                                                                                                           A company experiencing ordinary growth, has high liquidity and much unused borrowing capacity.                                                                                  A dividend-paying company that experiences an unexpected drop in earnings from the trend.                                                                                                A...
You are given a piece of eukaryotic DNA which is shown below                /6 marks 5’- CACTCACCCGATTTTTGAATGGCCCTGATGAATCTCTGGTAA -3’...
You are given a piece of eukaryotic DNA which is shown below                /6 marks 5’- CACTCACCCGATTTTTGAATGGCCCTGATGAATCTCTGGTAA -3’ a)  If this is the coding strand, what is the mRNA produced (label both the 3’ and 5’ ends)? b)  If this is the template strand, what is the mRNA produced (label both the 3’ and 5’ ends)? c)  Assuming that the DNA sequence above is the coding strand, predict the amino-acid sequence of the protein produced from the piece of mRNA using single letter codes. In...
ADVERTISEMENT
Subjects
ADVERTISEMENT
Latest Questions
ADVERTISEMENT