Podocytes in Bowman’s capsule form a molecular sieve which permits small molecules like to pass into...

Podocytes in Bowman’s capsule form a molecular sieve which permits small molecules like to pass into the filtrate in the initial stage of urine formation. Reabsorption of these small molecules is accomplished with the help of the located in the proximal convoluted tubule.

A. glucose; Na+, glucose cotransporter

B. albumin; countercurrent exchanger

C. albumin; Na+, proton-exchanger

D. glucose; countercurrent exchanger

Expert Solution

Solution:-

In initial stage of urine formation podocytes which lies just beneath the thickened glomerular basement membrane forms a small slits in which the fluid passes through into the nephron. The size of filtration slits restrict the passage of large molecules like albumin and cells like RBC and platelets. Here the blood pressure causes water, dissolved salts and small molecules like waste products, amino acids and glucose to leak through capillaries wall into the structure called Bowman's Capsule.

The proximal tubule are protein in the lining of cell that act like tiny molecular pumps to drive sodium ions out of the cell and potassium ions in. Solutes dissolved in water naturally tend to diffuse from areas of high to low concentration which causes sodium ions to flow back into the cell. Protein called sodium dependent glucose cotransporter 2 couples with cross membrane transport of sodium ion to transport of a glucose molecule.

So, the correct option is (A) glucose; Na+, glucose cotransporter.

gladiator answered 2 years ago

1. During the process of electrophoresis, the ________ functions like a molecular sieve, separating the samples...

1. During the process of electrophoresis, the ________ functions like a molecular sieve, separating the samples according to their size. A) agarose gel B) sample mixture C) positively charged electrode D) negatively charged electrode 2. The restriction enzyme SacI has a recognition sequence of GAGCT^C, where the caret (^) indicates the cut site. Examine the DNA molecule below. AGAGCTCAGTCGAGAGCTCAGATCGATAGGAGCTCAGATCTCGATCACCTC TCTCGAGTCAGCTCTCGAGTCTAGCTATCCTCGAGTCTAGAGCTAGTGGAG How many separate molecules of DNA would you end up with if you treated the above DNA molecule with SacI?...

Which of the following molecules can form hydrogen bonds?

Which of the following molecules can form hydrogen bonds? NaH H2O BH3 HI CH4

Which of the following molecules would you expect to have the largest molecular dipole (which is...

Which of the following molecules would you expect to have the largest molecular dipole (which is the most polar)? a) CH4 b) CH2F2 c) CH3F d) BF3 e) CF4

What is the molecular geometry of a molecules whose central atom is sp3d hybridized and which...

What is the molecular geometry of a molecules whose central atom is sp3d hybridized and which consists of only bonding electrons?

Which of the following pairs of elements are likely to form an ionic or a molecular...

Which of the following pairs of elements are likely to form an ionic or a molecular compound? Why? A. Calcium and Bromine B. Iron and Oxygen

Which of the following molecules has bond polarity but no molecular polarity? A: N2 B: SCl2...

Which of the following molecules has bond polarity but no molecular polarity? A: N2 B: SCl2 C: NH3 D: CO2 The VSEPR theory is used to predict molecular shapres, based on the arrangement of- A: lone pairs of electrons on the outer atoms B: lone pairs of electrons on the central atom C: bonding pairs of electrons on the central atom D: bonding and lone pairs on the central atom Which of these molecules has a central atom surrounded by...

The molecular orbitals associated with the π-bonding MOs in square cyclobutadiene (C4H4) are, like benzene, form...

The molecular orbitals associated with the π-bonding MOs in square cyclobutadiene (C4H4) are, like benzene, form by overlap of a single p-orbital on each carbon atom that is not involved in the sigma-bonding network of the molecule. These p-orbitals point perpendicularly with respect to the plane defined by the carbon atoms. There is no central atom, so the only interactions that matter are between the p-orbitals among themselves. i) draw the four π-orbitals of C4H4 ii) Use the idea that...

How do simple molecules like H2O ,NH3, ect form bonds with metals? ( Include the name...

How do simple molecules like H2O ,NH3, ect form bonds with metals? ( Include the name of the interaction)

Which of the following pairs of elements are likely to form an ionic or a molecular compound? Why?

Using the molecular orbital energy ordering for second-row homonuclear diatomic molecules in which the 20 orbitals...

Using the molecular orbital energy ordering for second-row homonuclear diatomic molecules in which the 20 orbitals lie at a lower energy than the 02p, draw the MO energy diagrams and predict the bond order in a molecule or ion with each number of total valence electrons. Will the molecule or ion be diamagnetic or paramagnetic? a) 6 valence electrons b) 9 valence electrons c) 12 valence electrons

Question