Question

In: Civil Engineering

QI: Think of a construction project-a highway connecting two major cities. Write down the steps involved...

QI: Think of a construction project-a highway connecting two major cities. Write down the steps involved in its planning and the steps involved in its scheduling.

Solutions

Expert Solution

Think of a construction project-a highway connecting two major cities. Write down the steps involved in its planning and the steps involved in its scheduling.

Planning and scheduling are two major parts of project management. Planning involves planning of mobilisation of resources, planning on sequence of activities, defining the scope to higher management, prepare an initial estimate, cost controlling, client co-ordination, submission of various reports, billing to client, scrutiny of subcontractor bills, etc.,

Step of Planning includes

1. Creation of Work Breakdown Structure [WBS] - The major works to be broken down to simpler works till zero level. A chart will be prepared by planning which will give clear details of the project.

2. Planning resources – once WBS is ready, number and type of resources [plant & machinery, manpower, material and money] required will be clearly known. Accordingly, the requirement is made as a report or document.

3. Read tender documents and understand employer requirement and contractual conditions – with the help of contracts team, main requirement for the project is noted and resources are allocated to execute the same

4. Schedule –

a. Create WBS

b. Finalise methodology of works

c. Finalise the cycle time

d. Finalise the resources required

e. Finalise the sequence of execution of works

f. Consideration of monsoon and monsoon effects

5. Once the schedule is in place, timeline of resource required for mobilisation is prepared and same will be used

6. Legal approvals are noted down and given to administration department to execute the same

7. Scope definition and Progress updation at frequent intervals will be done by planning.

8. Billing to client at regular intervals as mentioned in contract

9. Working closely with execution team on their requirement and providing the same

10. Cost control all throughout the project

11. Optimisation of cost in the project

12. Closing of project


Related Solutions

Highway engineers estimate that the main highway between two cities has a 1% probability of being...
Highway engineers estimate that the main highway between two cities has a 1% probability of being blocked in good weather, and a 5% probability of being blocked in snowy weather. The detour route, on the other hand, is a smaller road which has a 2% probability of being blocked in good weather and a 15% probability of being blocked when it snows. On a certain day, forecasters predict a 60% chance of snow. a. Are the events that it snows...
Describe the major steps in the construction of portfolio objectives.
Describe the major steps in the construction of portfolio objectives.
Consider the following project regarding the building of a large bridge between two major cities. The...
Consider the following project regarding the building of a large bridge between two major cities. The bridge will involve a ‘toll’ or monetary charge, where users of the bridge will pay an amount of money each time that they cross over the bridge. The current date is 1 January 2019. The bridge is expected to take 2 years to build, and the first paid crossing of the bridge will occur in exactly 2 years from now. The costs of the...
Given this segment of a double-stranded DNA molecule, draw the two major steps involved in DNA...
Given this segment of a double-stranded DNA molecule, draw the two major steps involved in DNA replication: ATCGGCTAGCTACGGCTATTTACGGCATAT TAGCCGATCGATGCCGATAAATGCCGTATA
Write out the Highway Project Development Process in order:
Write out the Highway Project Development Process in order:
24. What is project crashing ? What are the 4 steps involved in the project crashing?...
24. What is project crashing ? What are the 4 steps involved in the project crashing? Explain. What is the LP formulation of the project crashing problem? What are the decision variables, constraints and the objective function of the LP formulation of crashing problem? Please answer question fully for a rating
Identify and explain the major steps involved in preparing the statement of cash flows.
Identify and explain the major steps involved in preparing the statement of cash flows.
The two major constraints that can hamper a construction project are time and resources. What actions...
The two major constraints that can hamper a construction project are time and resources. What actions can a project manager undertake to overcome these constraints?
write a review on the existence and growth of cities. Please be sure to think about...
write a review on the existence and growth of cities. Please be sure to think about how geography affects economic activity.
A major cause of injuries in highway work zones is weak construction barriers. One federal government...
A major cause of injuries in highway work zones is weak construction barriers. One federal government road-barrier specification involves the velocity of a front-seat passenger immediately following impact. This mean impact velocity must be less than 12 m/s. TSS GmbH, a German company, has just developed a new high-impact road barrier with special absorbing material. In controlled tests the impact velocity was measured for 9 randomly selected crashes. The sample mean was 11.85 m/s. Assume the distribution of impact velocities...
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT