Question

In: Biology

Which of these is a heterotroph? Multiple Choice a phytoplanktonic diatom a moss plant an oak...

Which of these is a heterotroph?

Multiple Choice

  • a phytoplanktonic diatom

  • a moss plant

  • an oak tree

  • a corn plant

  • a fish

Solutions

Expert Solution

In the given options some are heterotrophs and some are not the organisms that are heterotrohs are

1)phytoplanktonic diatom:Diatoms are mainly photosynthetic but some are obligate heterotrophs and can live in the absence of light provided an appropriate organic carbon source is available.

2)moss plant: mosses belong to the division bryophyta consequently the sporophyte of the moss is heterotrophic and parasitic during gametophytic phase

3)oak tree: The oak tree is an 'autotroph'makes its own food from chemical or light energies

4)corn plant: heterotroph depend either directly or indirectly on autotrophs for nutrients and food energy.for eg raccons might consume corn planted in a field,or they might catch and eat rodents that rely on corn as a food source

5)fish: heterotrophs are organisms which cant make their own food ,so that it has to depend on others for food and other things. the fish also comes under heterotroph because it depend on plants and other creatures for food.


Related Solutions

Which of the following statements is true of the Magnuson-Moss Warranty Act? Multiple Choice It requires...
Which of the following statements is true of the Magnuson-Moss Warranty Act? Multiple Choice It requires the seller to make the written warranty terms available to the prospective buyer before the sale. It does not allow consumers to sue the maker of the warranty for failure to fulfill its terms. It enforces the seller's obligation to make the terms available only after the sale. It permits consumers to sue the manufacturer if the manufacturer offers the warranty, but not the...
Which of the following accurately describes a company’s choice of inventory cost method? Multiple Choice A...
Which of the following accurately describes a company’s choice of inventory cost method? Multiple Choice A company can choose which inventory method it prefers, even if the method does not match the actual physical flow of goods. Once a company chooses a method, it is not allowed to frequently change to another one. All of the other answers are correct. A company need not use the same method for all of its inventory.
Multiple Choice Identify the choice that best completes the statement or answers the question. ____​13.​Which of...
Multiple Choice Identify the choice that best completes the statement or answers the question. ____​13.​Which of the following statements is CORRECT? a. One of the disadvantages of incorporating a business is that the owners then become subject to liabilities in the event the firm goes bankrupt. b. Sole proprietorships are subject to more regulations than corporations. c. In any type of partnership, every partner has the same rights, privileges, and liability exposure as every other partner. d. Sole proprietorships and...
Which of the following is NOT a goal of an accounting system? Multiple Choice to accumulate...
Which of the following is NOT a goal of an accounting system? Multiple Choice to accumulate data about a firm’s financial affairs to classify data about a firm’s financial affairs in a meaningful way to interpret the relative success of a business through the examination of data about its financial affairs to summarize data about a firm’s financial affairs in periodic reports called financial statements
Which of the following are not examples of operating costs for an IT investment? Multiple Choice...
Which of the following are not examples of operating costs for an IT investment? Multiple Choice Costs of routine hardware replacements over time Cost of contract for help desk support Costs of disposal of electronics at end of life Costs of software license renewals All of the choices are examples of operating costs.
Which of the following is NOT true of the relaxation of a muscle fiber? Multiple Choice...
Which of the following is NOT true of the relaxation of a muscle fiber? Multiple Choice calcium release channels open allowing Ca to leave SR ATP is needed to fuel the calcium ATPase pumping Ca into SR Ca2+ moves from the sarcoplasm into the sarcoplasmic reticulum (SR) Action potentials must cease
Given the DNA sequence matrix below: Fern AGCCCAGGCTTCGAATGTCC Pine AGCTTCAGTGTCGCACTTCC Oak AGCTTCAGCGTCACACATCC Moss AACCTTGGTGTCAAACGTCC 1. Assuming...
Given the DNA sequence matrix below: Fern AGCCCAGGCTTCGAATGTCC Pine AGCTTCAGTGTCGCACTTCC Oak AGCTTCAGCGTCACACATCC Moss AACCTTGGTGTCAAACGTCC 1. Assuming that Moss is the outgroup, draw all three possible trees of evolutionary relationships among these species. Label your trees A, B, and C. 2. Sum up the number of differences between the DNA sequences for all pairs of species (There are 6 total pairs of species to be compared). Based on these values, which tree (A, B, or C) do you think is best...
Answers to Multiple-Choice Problems: A student wants to see if the correct answers to multiple choice...
Answers to Multiple-Choice Problems: A student wants to see if the correct answers to multiple choice problems are evenly distributed. She heard a rumor that if you don't know the answer, you should always pick C. In a sample of 100 multiple-choice questions from prior tests and quizzes, the distribution of correct answers are given in the table below. In all of these questions, there were four options {A, B, C, D}. Correct Answers (n = 100) A B C...
Multiple Choice Question: Jennifer Jones, a 38-year-old employee at a metal fabricating plant, was injured in...
Multiple Choice Question: Jennifer Jones, a 38-year-old employee at a metal fabricating plant, was injured in a work-related accident. She has not returned to work and her doctor states that she has permanent back injuries that preclude her from performing the job activities that were required of her at the metal fabricating plant and, in fact, her injuries made it impossible to work anywhere. Her employer claims that Jennifer's injury claims are grossly exaggerated and she could, in fact, return...
Suppose that you are taking a multiple choice test (consisting of only 4-answer-choice questions) for which...
Suppose that you are taking a multiple choice test (consisting of only 4-answer-choice questions) for which you have mastered 60% of the material. When you actually take the test, if you know the answer of a question, then you will answer it correctly for sure; if you do not know the answer, however, you can still guess the answer (meaning that you will have 25% chance of getting the correct answer). Finally, assume that your answer to each question is...
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT