To complete the table,below, consider the following elements of the system: [lacI promoter, lacI protein coding...

To complete the table,below, consider the following elements of the system:

[lacI promoter, lacI protein coding region, lacZ/Y promoter, lacZ protein coding for B-Galactotosidase, lacY protein coding for Permease, and operator]

Complete the table by using the pull down menu to select for “+” or “-“ symbols to show if β-Galactotosidase or Permease protein are produced in bacteria with the follow genotypes.

(for reference)	B-*Galactotosidase (lacZ)*		*Permease (lacY)*
(for reference)	No Lactose	Lactose Present	No Lactose	Lactose Present
lacP^I+ lacI- lacP^zya- lacO+ lacZ+ lacY+
lacP^I+ lacI- lacP^zya+ lacO⁺ lacZ- lacY+
lacP^I+ lacI^S lacP^zya+ lacO^C lacZ+ lacY+
lacP^I+ lacI+ lacP^zya+ lacO+ lacZ- lacY+

Solutions

Expert Solution

lac repressor inhibits the expression of the lac operon if the inducer is absent, lactose is an inducer of the lac operon when the lactose is present lac repressor is inhibited by lactose, so lac operon can be expressed.

lacPI+ - promoter of lac I gene.

lacI+ - functional lac I gene that codes for lac repressor.

lacPzya+ - promoter of lac operon.

lacO+ -lac operator.

lacZ+- codes for beta-galactosidase

lacY+ - codes for permease.

	beta-galactosidase	permease
	lactose present	lactose absent	lactose present	lactose absent
lacPI+ lacI- lacPzya- lacO+ lacZ+ lacY+	lac I gene is mutated so functional lac repressor is not produced, also the promoter of the lac operon is mutated so this lac operon will not be expressed in any conditions -	lac I gene is mutated so functional lac repressor is not produced, also the promoter of the lac operon is mutated so this lac operon will not be expressed in any conditions -	lac I gene is mutated so functional lac repressor is not produced, also the promoter of the lac operon is mutated so this lac operon will not be expressed in any conditions -	lac I gene is mutated so functional lac repressor is not produced, also the promoter of the lac operon is mutated so this lac operon will not be expressed in any conditions -
lacPI+ lacI- lacPzya+ lacO+ lacZ- lacY+	lac repressor is mutated, so lac operon will be expressed even if lactose is absent, but lac Z gene is mutated so beta-galactosidase cannot be produced -	lac repressor is mutated, so lac operon will be expressed even if lactose is absent,but lac Z gene is mutated so beta-galactosidase cannot be produced -	lac repressor is mutated, so lac operon will be expressed even if lactose is absent, so permease is produced in the cell always, +	lac repressor is mutated, so lac operon will be expressed even if lactose is absent,so permease is produced in the cell always, +
lacPI+ lacIS lacPzya+ lacOC lacZ+ lacY+	lac repressor is lac Is, it is super-repressor, which inhibits the lac operon even if inducer is present, but this operon has constitutive operator which cannot be inhibited by lac repressor so lac operon is expressed always +	lac repressor is lac Is, it is super-repressor, which inhibits the lac operon even if inducer is present, but this operon has constitutive operator which cannot be inhibited by lac repressor so lac operon is expressed always +	lac repressor is lac Is, it is super-repressor, which inhibits the lac operon even if inducer is present, but this operon has constitutive operator which cannot be inhibited by lac repressor so lac operon is expressed always +	lac repressor is lac Is, it is super-repressor, which inhibits the lac operon even if inducer is present, but this operon has constitutive operator which cannot be inhibited by lac repressor so lac operon is expressed always +
lacPI+ lacI+ lacPzya+ lacO+ lacZ- lacY+	here regulatory elements are functional but beta-galactosidase is mutated so beta-galactosidase cannot be produced even if inducer is present -	here regulatory elements are functional but beta-galactosidase is mutated so beta-galactosidase cannot be produced even if inducer is present -	here regulatory elements are functional, so lac operon is expressed in the presence of inducer, so permease is produced when lactose is present +	here regulatory elements are functional, so lac operon is expressed in the presence of inducer, so permease is produced when lactose is present and it cannot be produced in the absence of inducer -

gladiator answered 1 year ago

Next > < Previous

Related Solutions

To complete the table,below, consider the following elements of the system: [lacI promoter, lacI protein coding...

To complete the table,below, consider the following elements of the system: [lacI promoter, lacI protein coding region, lacZ/Y promoter, lacZ protein coding for B-Galactotosidase, lacY protein coding for Permease, and operator] Complete the table by using the pull down menu to select for “+” or “-“ symbols to show if β-Galactotosidase or Permease protein are produced in bacteria with the follow genotypes. (For Reference) B-Galactotosidase (lacZ) Permease (lacY) No Lactose Lactose Present No Lactose Lactose Present lacPI+ lacI+ lacPzya+ lacO+...

Question 3: Transcription and Translation Below is the beginning of the coding strand of the protein-coding...

Question 3: Transcription and Translation Below is the beginning of the coding strand of the protein-coding region of the Cdc7 gene in yeast. Note that only the coding strand of the DNA is shown. Please be sure to correctly label the ends of any DNA, RNA or protein sequence written below. 5’ATGACAAGCAAAACGAAGAATATCGATGATATACCTCCAGAAATCAAAGAAGAGATGA TACAGCTCTATCATGATCTACCGGGTATAGAAAATGAATATAAACTCATAGACAAGATC GGTGAGGGAACATTTTCGTCAGTGTATAAAGCCAAAGATATCACTGGGAAAATAATAG3’ A. What is the sequence of the first 10 nucleotides of the template strand? B. What is the sequence of the first 10 nucleotides of the...

Consider the following contingency table of observed frequencies. Complete parts a. through d. below. Click the...

Consider the following contingency table of observed frequencies. Complete parts a. through d. below. Click the icon to view the contingency table. Column Variable Row Variable C1 C2 C3 R1 11 9 12 R2 11 6 6 a. Identify the null and alternative hypotheses for a chi-square test of independence with based on the information in the table. This test will have a significance level of alpha α=0.01. Choose the correct answer below. A. H0: The...

Consider the production information below: A. Complete the following table: # of L Output/Week MPL Price...

Consider the production information below: A. Complete the following table: # of L Output/Week MPL Price of Output MRPL 0 0 $10 - 1 100 $10 2 180 $10 3 240 $10 4 280 $10 5 300 $10 6 310 $10 7 315 $10 B. If this firm would have to pay $500 a week, how many workers would the firm hire? Explain how you come up with your answer. C. If the demand for the products increase such that...

Complete the following table then draw the complete circular flow diagram in the space below for...

Complete the following table then draw the complete circular flow diagram in the space below for each row: (consult your notes for the abbreviations. Each row is independent of the others) Y C I G T S Import Export NX NCO Row 1 1000 800 400 400 850 700 Row 2 1500 750 250 500 400 -200 2.Critical Thinking: Let’s make it as realistic as possible to the US. In 2018, the US had both a government and trade deficit. With that in mind,...

Consider the following contingency table of observed frequencies. Complete parts a. through d. below. Column Variable...

Consider the following contingency table of observed frequencies. Complete parts a. through d. below. Column Variable Row Variable C1 C2 C3 R1 7 6 9 R2 11 9 8 a. Identify the null and alternative hypotheses for a chi-square test of independence with based on the information in the table. This test will have a significance level of α=0.05. Choose the correct answer below. A. H0: The variables R1, R2, C1, C2, and C3 are independent. H1: At least one...

Consider the following contingency table of observed frequencies. Complete parts a. through e. below. Column Variable...

Consider the following contingency table of observed frequencies. Complete parts a. through e. below. Column Variable Row Variable Upper C 1C1 Upper C 2C2 Upper C 3C3 Upper R 1R1 2020 77 1818 Upper R 2R2 88 88 1313 Upper R 3R3 88 1616 6 Click the icon to view the contingency table.a. Identify the null and alternative hypotheses for a chi-square test of independence based on the information in the table. This test will have a significance level of...

Complete the following table: Kinesin Dynein Structure Function(s) in a cell Direction that this motor protein...

Complete the following table: Kinesin Dynein Structure Function(s) in a cell Direction that this motor protein moves *Highlight or use a different text color for similarities shared between kinesin and dynein. Complete the following table: Cilia Flagella Structures Function(s) Types of movements, and how these occur *Highlight or use different text colors for similarities shared between cilia and flagella.

The following HTML tags will be used to complete assignment below: · <table> · <tr> ·...

The following HTML tags will be used to complete assignment below: · <table> · <tr> · <td> Explore CSS and the various ways attributes can be manipulated to change the width and style of table borders in addition to the physical dimensions of the space that resides within each cell. Demonstrate mastery of the concepts of "absolute" vs. "relative" sizes when specifying table dimensions and create a traditional 12x12 multiplication table and a different HTML table on the same markup...

Below is a segment of coding sequence from the overlapping Ink4A-Arflocus (top line) and protein sequence...

Below is a segment of coding sequence from the overlapping Ink4A-Arflocus (top line) and protein sequence from Ink4A(line 2, zero frame) and Arf(line 3, +2 frame). caggtcatgatgatgggcagcgcccgagtggcggagctgctgctgctccacggcgcggag Q V M M M G S A R V A E L L L L H G A E G H D D G Q R P S G G A A A A P R R G -What bases could be used to maintain this Leucine codon in Ink4A but mutate the Proline codon in Arf? - What amino acid codons could be introduced into Arf Proline codon without changing the Ink4A Leucine codon? - What mutant amino acids may...

Subjects