Apamine is a small monomeric peptide toxin present in the venom of the honeybee. It has...

Apamine is a small monomeric peptide toxin present in the venom of the honeybee. It has the sequence: CNCKAPETALCARRCQQH

A It is known that apamine does NOT react with iodoacetate. How many disulfide bonds are present?

B Suppose trypsin cleavage gave two peptides. Where is (are) the S-S bond(s)? (Hints: If cut by trypsin, but still held together by a disulfide bond, count it as a single peptide. Also, do not count a single amino acid as a “peptide.”)

PLEASE ANSWER B!!!! YOU CAN SKIP A IF YOU WANT I CAN FIGURE IT OUT

Expert Solution

queen_honey_blossom answered 2 years ago

Do every MHC class II molecule on a single dendritic cell present the same peptide fragment?

Venom production in your rattlesnake population has a phenotypic mean of 400 mg, a phenotypic standard...

Venom production in your rattlesnake population has a phenotypic mean of 400 mg, a phenotypic standard deviation of 36 mg, and a narrow-sense heritability of 0.25. The mean generation interval is 2 years. If you perform phenotypic selection by culling the bottom 10% of individuals each generation (i = 0.2), approximately how many years will it take for your population to reach a phenotypic mean of 450 mg? Explain how 56 is the correct amount of years to reach a...

Hexavalent chromium has been identified as an inhalation carcinogen and an air toxin of concern in...

Hexavalent chromium has been identified as an inhalation carcinogen and an air toxin of concern in a number of different locales. An article gave the accompanying data on both indoor and outdoor concentration (nanograms/m3) for a sample of houses selected from a certain region. House 1 2 3 4 5 6 7 8 9 Indoor 0.11 0.12 0.13 0.16 0.16 0.16 0.17 0.18 0.19 Outdoor 0.25 0.64 0.43 0.50 0.93 0.31 0.45 0.80 0.82 House 10 11 12 13 14...

Recent evidence suggests that certain Gram positive bacteria communicate using a small peptide called Nisin. The...

Recent evidence suggests that certain Gram positive bacteria communicate using a small peptide called Nisin. The peptide is 8 amino acids long. The Shine Dalgarno sequence used by this bacterium located is AGGAGGU and is located approximately 5 nucleotides away (upstream) of the start codon of the ORF. Below is one strand of DNA corresponding to a region on the bacterial chromosome which contains the ORF for nisin. 5’ GGTCGTGCTGGGTTGAGAAATGCCTACGTGCTGCTAGTTGGGAGCTCCATAGGGGACCTCCTGGGT 3’ You desire to clone this gene and express Nisin...

1. Botulinum toxin has been proposed as a treatment for the symptoms of tetanus. Discuss why...

1. Botulinum toxin has been proposed as a treatment for the symptoms of tetanus. Discuss why this might be useful.

Suppose USA is a small country in sugar market. At present, there is no tariff on...

Suppose USA is a small country in sugar market. At present, there is no tariff on sugar import. However, beginning January 2015, the U.S. government starts levying 10 % tariff on sugar import. Using an appropriate graphs explain what happens in the U.S. sugar market? Who gains, who loses and what will be overall welfare effect?

A peptide has the following sequence: A-K-R-H-G-E-E-R (Ala-Lys-Arg-His-Gly-Glu-Glu-Arg). What is the pI for this peptide? You...

A peptide has the following sequence: A-K-R-H-G-E-E-R (Ala-Lys-Arg-His-Gly-Glu-Glu-Arg). What is the pI for this peptide? You can use even integer approximations for pKa values: I know the answer is 9.5 but I need to know how to get to this answer.

Oxytocin is a nonprotein peptide (therefore has less than 40 amino acids). What is the charge...

Oxytocin is a nonprotein peptide (therefore has less than 40 amino acids). What is the charge on this peptide at pH 6.8?

How can small businesses thrive with minimum wage present and increasing?

Problem 13-28 Net Present Value Analysis [LO13-2] Bilboa Freightlines, S.A., of Panama, has a small truck...

Problem 13-28 Net Present Value Analysis [LO13-2] Bilboa Freightlines, S.A., of Panama, has a small truck that it uses for intracity deliveries. The truck is worn out and must be either overhauled or replaced with a new truck. The company has assembled the following information: Present Truck New Truck Purchase cost new $ 34,000 $ 44,000 Remaining book value $ 21,000 - Overhaul needed now $ 20,000 - Annual cash operating costs $ 16,500 $ 15,000 Salvage value-now $ 10,000...

Question