Question

Recent evidence suggests that certain Gram positive bacteria communicate using a small peptide called Nisin. The peptide is 8 amino acids long. The Shine Dalgarno sequence used by this bacterium located is AGGAGGU and is located approximately 5 nucleotides away (upstream) of the start codon of the ORF. Below is one strand of DNA corresponding to a region on the bacterial chromosome which contains the ORF for nisin.

5’ GGTCGTGCTGGGTTGAGAAATGCCTACGTGCTGCTAGTTGGGAGCTCCATAGGGGACCTCCTGGGT 3’

You desire to clone this gene and express Nisin as a fusion with an N-terminal His Tag for protein purification and decide to use the expression vector depicted below. You are a new researcher in the department, and since funding is scarce, you have access to only the following restriction enzymes:

SacI, SalI, XhoI, NcoI

Question 1: ( /2)

What is the amino acid sequence of native Nisin? (Include amino (N) and carboxy (C) termini, express using three letter codes).

____________________________________________

Question 2: Design two primers (one forward and one reverse) which you would use to amplify your gene using PCR, and subsequently clone it directionally into the pET28 vector whose map is provided. Each primer should be exactly 15 nucleotides in size in TOTAL. Be sure to indicate 5’ and 3’ ends.

Primer 1: ( /2) ____________________________________

Primer 2: ( /2) ____________________________________

Question 3: Unfortunately, your attempt to purify the fusion protein failed. You suspect that it may be due to the fact that the N-terminal fusion is causing problems for the protein to fold correctly. You decide to make a C-terminal fusion. Design two primers (one forward and one reverse) which you would use to amplify your gene using PCR. You would like to add the least amount of any additional amino acids as possible your fusion protein. Each primer should be exactly 15 nucleotides in size in TOTAL. Be sure to indicate 5’ and 3’ ends.

Primer 1: ( /2) ____________________________________

Primer 2: ( /2) ____________________________________

Question 4:

Unfortunately, you are STILL having no success in detecting your fusion protein after using affinity chromatography! What a nightmare! You want to determine if the inability to isolate your N-terminal fusion protein is due to a failure to clone your gene, if it’s due to transcription failure, or due to translation inefficiency.

a) Is there a single enzyme in your toolkit which would digest your pET28 vector and your pET-nisin recombinant vector a different number of times? If yes, which would it be and how many fragments, assuming perfect resolution, would you expect to see after performing gel electrophoresis on each sample? (2)

Enzyme:

PET28 vector result:

PET28-nisin recombinant vector result:

b) Describe a molecular biology technique which you can use in order to determine if your C-terminal fusion gene is being transcribed properly. You can have access to any reagents (1)

c) Describe a molecular biology technique which you can use in order to determine if your C-terminal fusion protein is indeed being translated. You can have access to any reagents. (1)

Answer 1

A.

Given sequence:

GGTCGTGCTGGGTTGAGAAATGCCTACGTGCTGCTAGTTGGGAGCTCCATAGGGGACCTCCTGGGT

Reverse Complement:

ACCCAGGAGGTCCCCTATGGAGCTCCCAACTAGCAGCACGTAGGCATTTCTCAACCCAGCACGACC

Red colour region shine Dalgarno sequence.

Green: the highlighted region is nisin ORF

Nisin is 8 amino acid long

    N- ATG GAG CTC   CCA   ACT AGC AGC   ACG    TAG -C

  N- Met E L P T S S T    Stop-C

B.

Primer design:

Nisin Sequence: 5'-ATGGAGCTCCCAACTAGCAGCACGTAG-3'

SalI - 5'-GTCGAC-3' will be added with forward primer

XhoI-5'-CTCGAG-3' will add with reverse primer

Forward Primer: 5'-GTC GAC-ATG GAG CTC -3

Reverse Primer:5'-CTCGAGCTACGTGCT-3'

C. Primer Development for C-terminal his tag:

DNA sequence for nisin :

5'-ATGGAGCTCCCAACTAGCAGCACGTAG-3'

We need to add C-terminal His tag

His tag sequence:

5'-CAT CAC CAT CAC CAT CAC -3'

but for a successful fusion, we need to remove stop codon from our sequence.

Nisin sequence after removing stop codon:

5'-ATGGAGCTCCCAACTAGCAGCACG-3'

So total fusion protein sequence:5'-ATG GAG CTC CCA ACT AGC AGC ACG CAT CAC CAT CAC CAT CAC-3'

Restriction enzyme selected: SalI - 5'-GTCGAC-3' will be added with forward primer

XhoI-5'-CTCGAG-3' will add with reverse primer.

Reverse complement sequence for reverse primer: 5'-CAC CAT CAC-3' = 5'-GTGATGGTG-3'

Forward primer:5'-GTCGAC-ATG GAG CTC -3'

Reverse Primer:5'-CTCGAG-GTGATGGTG-3'

4.

SacI : is the enzyme

Empty pET 28 a it is having single cutting site so digestion with it will lead to 1 band after amplification linearized vector.

pET28a+ nisin it is having 2 sites leads to 2 fragments.

The C-terminal amino acid can be determined by addition of carboxypeptidases, enzymes which cleave amino acids from the C-terminal. or we can simply sequence the protein.