Based on the excerpts from Dambisa Moyo's book, Dead Aid, answer the following questions: Why is...

Based on the excerpts from Dambisa Moyo's book, Dead Aid, answer the following questions:

Why is aid not working? What are the possible sources for Africa's underdevelopment?
What is the aid effectiveness paradox?
Do you agree or disagree with Moyo's overall argument, that we should end development assistance to African countries? Why or why not?

Expert Solution

Moyo says this aid is ineffective but very fatal. They argue that despite over $ 1 trillion in aid over the past five decades, aid has failed to achieve poverty reduction and sustainable economic growth. In fact, this aid has only made Africa worse.The fraudulent aid culture has made Africa more indebted and Africa has been driven to inflation and economic slowdown.

Most of the African countries face corruption, internal unrest, military rule, underdevelopment and extreme poverty because Africa is underdeveloped with immense manpower, natural resources and a good ecological and cultural economy.Africa is a fragile economy that is hit by literacy, health and other social indicators

Studies in Africa have attempted to dispel this paradox. When countries have been doing well for some time, average incomes increase. Then donors tend to show less support. This suggests that over time, good performers get less help and poor performers get more help.

I do not agree with Moe's argument that Africa should end aid, but that it requires sincere cooperation, means and means for effective use of aid. Western countries should adopt new programs with political will and encourage international trade among African countries.

Rahul Sunny answered 2 years ago

15. Refer to the attached excerpts from the Wall Street Journal, to answer the following questions:...

15. Refer to the attached excerpts from the Wall Street Journal, to answer the following questions: (the excerpts show the closing prices as of Thursday January 23, 2020 and Wednesday April 1, 2020). A. You purchased a T-bill on Thursday January 23, 2020 which matures on July 30, 2020. Determine the purchase price of the T-bill (how much you paid for it). Use the excerpt of January 23 to get the price B. On Wednesday April 1, 2020, you sold...

3. With the aid of a diagram, answer the following questions: (i) What is meant by...

3. With the aid of a diagram, answer the following questions: (i) What is meant by the term Efficient Frontier? (Assume no short sales and no riskless lending and borrowing allowed.) (ii) ‘The mean-variance efficiency criterion can identify the optimal investment’. Do you agree this statement? Explain your answer.

Please build the answer based on the following text from a studying book: Reporting Pension Contributions...

Please build the answer based on the following text from a studying book: Reporting Pension Contributions and Adjustments The following are some general year-end reporting guidelines employers should follow when reporting pension contributions and pension adjustments (PAs):  employee contributions to a registered pension plan (RPP) are tax deductible; they are reported in box 20 on the T4 slip  employee and employer contributions to a defined contribution pension plan are part of the PA that is reported in box...

answer following questions from the Traffic Signal Systems Operations and Design Book 1. What is the...

answer following questions from the Traffic Signal Systems Operations and Design Book 1. What is the purpose of the ring barrier diagram? 2. How is timing represented in a ring barrier diagram? 3. Why use a ring barrier diagram instead of a conflict matrix to describe the sequencing of phases? 4. What is the difference between a movement and a phase ?

Answer the following questions based on the following financial information taken from the trial balance for...

Answer the following questions based on the following financial information taken from the trial balance for New Day, Inc: Year 2 Year 1 Account title Debit (Credit) Debit(Credit) Cash 281,000 297,000 Accounts receivable 12,000 14,000 Prepaid expenses 2,000 8,000 Inventory 581,000 321,000 PPE 926,000 926,000 Accumulated Deprn (581,000) (581,000) Patents 19,000 19,000 Accounts Payable (11,000) (17,000) Interest Payable (3,000) (4,000) Bonds Payable (750,000) (750,000) Common Stock (50,000) (50,000) Retained Earnings (426,000) ...

With the aid of graphic organizers, answer the following questions. Show the relationship between regionalism and...

With the aid of graphic organizers, answer the following questions. Show the relationship between regionalism and globalization, and present how state-to-state regionalism differs from non-state regionalism.

Based on this course lectures, our previous F2F answer the following questions: 1. Why is it...

Based on this course lectures, our previous F2F answer the following questions: 1. Why is it a must that performance standards be derived from the company's strategic goals in addition to being based on job analysis and job description information? Provide an example. 2. To which extent do you believe that corporations should make their employees well-aware of how their pay structure is derived? Why? 3. What benefits can be achieved when H.R managers implement competency-based compensation programs that reward...

Please build the answer based on following text from studying book: Expense Accounts. Expenses are costs...

Please build the answer based on following text from studying book: Expense Accounts. Expenses are costs incurred by an organization in the process of earning revenue during a given period of time. Typical expense accounts related to payroll would include such items as wages, salaries, employer payroll expenses, and group insurance benefit expenses. Payroll expenses have a direct impact on the profitability of an organization. In an expense account, debit entries increase the expense balance and credit entries decrease the...

Question (1) Answer each of the following questions briefly. These questions are based on the following...

Question (1) Answer each of the following questions briefly. These questions are based on the following relational schema: Emp(eid: integer, ename: string, age: integer, salary: real) Works(eid: integer, did: integer, pcttime: integer) Dept(did: integer, dname: string, budget: real, managerid: integer) (a) (5 points) Give an example of a foreign key constraint that involves the Dept relation. What are the options for enforcing this constraint when a user attempts to delete a Dept tuple? (b) (5 points) Write the SQL statements...

Answer the following questions based on this codingstrand of DNA: &nbs

Answer the following questions based on this codingstrand of DNA: 5’ GGCCATGACAGAGGAGCAAAAGTTATTGCT 3’ Drennan et al. (1996) identified several mutations in this enzyme that result in methylmalonic acidemia (MMA). One of those mutations is a C to A at base pair 1904 in the coding strand of DNA (bold and italicized in the template strand). Write the unique coding strand of DNA for this patient and highlight the change you made. Write it 5’ to 3’. Write the mRNA sequence...

Question