. In the primary sequence of a protein, a valine is substituted in place of a...

. In the primary sequence of a protein, a valine is substituted in place of a glutamic acid. Which of the following statements is true? a. This is a transition from a non-polar amino acid to a polar amino acid. b. This will affect the secondary protein structure. c. This is a transition from a hydrophobic amino acid to a hydrophilic amino acid. d. This will have no effect on the protein. e. This is a silent mutation.

Expert Solution

The following statements that are true-

a. This is a transition from a non-polar amino acid to a polar amino acid.

b. This will affect the secondary protein structure.

c. This is a transition from a hydrophobic amino acid to a hydrophilic amino acid.

All the 3 options are correct but if you have to select a single option then the answer is-

b. This will affect the secondary protein structure.

Valine is a non polar, hydrophobic amino acid where as Glutamic acid is polar, hydrophilic amino acid. All polar things can form hydrogen bond with water that is why they are more soluble in water.

And non polar, hydrophobic amino acids tend to cluster together within proteins. These amino acids makes the interior of the protein and gives stability to the protein structure through hydrophobic interactions. So substitution of valine with glutamic acid will affect the protein secondary sructure as it will alter stability.

gladiator answered 1 year ago

the aminoacid sequence in protein is referred to as the: primary structure secondary structure pl configuration...

the aminoacid sequence in protein is referred to as the: primary structure secondary structure pl configuration conformation which one?

It is possible to make some predictions about protein secondary structure based on the primary sequence....

It is possible to make some predictions about protein secondary structure based on the primary sequence. Consider the following amino acid sequence: 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 Ile-Ala-His-Thr-Tyr-Gly-Pro-Phe-Glu-Ala-Ala-Met-Cys-Lys-Trp-Glu-Ala-Gln-Pro-Asp-Gly-Met-Glu-Cys-Ala-Phe-His-Arg A) Where might Beta-Turns occur? B) Where might intrachain disulfide cross-linkages be formed? C) Assuming that this sequence is part of a larger globular protein, what is the probable...

This protein sequence forms an antiparallel coiled-coil. Place the peptides onto a helical wheel diagram and...

This protein sequence forms an antiparallel coiled-coil. Place the peptides onto a helical wheel diagram and show which faces interact in the coiled-coil. Identify key interactions that stabilize the coiled-coil. I L R L E R E I E D L Q K M K

Place the events listed below in the correct chronological order for protein synthesis. A protein is...

Place the events listed below in the correct chronological order for protein synthesis. A protein is produced Genome in nucleus Ribosome adds an amino acid to a growing amino acid chain Gene copied as mRNA tRNA anticodon binds to mRNA codon mRNA joins ribosome

The hydrophobic effect is the primary driving force for protein folding because A) a folded protein...

The hydrophobic effect is the primary driving force for protein folding because A) a folded protein maximizes the entropy of water B) an unfolded protein maximizes the entropy of a biological system C) a folded protein is able to form the most hydrogen bonds D) hydrogen bonds within the protein replace hydrogen bonds between the protein and water

substituted chalcones will be synthesized. In this reaction, 3-hydroxy-4-methoxy benzaldehyde will be reacted with a substituted...

substituted chalcones will be synthesized. In this reaction, 3-hydroxy-4-methoxy benzaldehyde will be reacted with a substituted acetophenone in the presence of NaOH. In light of this, why is it necessary to protect the alcohol group of 3-hydroxy-4-methoxy benzaldehyde? Briefly explain how IR analysis will help you determine if the desired protected alcohol product were synthesized; in other words, what peaks would you expect to disappear and what peaks would you expect to appear? BE SPECIFIC – include absorption values (cm-1)!

Below is a segment of coding sequence from the overlapping Ink4A-Arflocus (top line) and protein sequence...

Below is a segment of coding sequence from the overlapping Ink4A-Arflocus (top line) and protein sequence from Ink4A(line 2, zero frame) and Arf(line 3, +2 frame). caggtcatgatgatgggcagcgcccgagtggcggagctgctgctgctccacggcgcggag Q V M M M G S A R V A E L L L L H G A E G H D D G Q R P S G G A A A A P R R G -What bases could be used to maintain this Leucine codon in Ink4A but mutate the Proline codon in Arf? - What amino acid codons could be introduced into Arf Proline codon without changing the Ink4A Leucine codon? - What mutant amino acids may...

Primary sequence of Papain- like protease of Covid-19

Below is the sequence for the SARS-CoV-2 spike protein that encodes a 1757 amino acid protein...

Below is the sequence for the SARS-CoV-2 spike protein that encodes a 1757 amino acid protein capable of binding surface receptors on some cell types. The nucleotide sequence is from base pair 21,563 to 25,384 in the viral genome (numbers in left-most column). Upon binding, the virus is uptaken into the cell, the coat is shed, and viral RNA released into the cytoplasm. When this occurs, host cell ribosomes begin transcription and translation of the RNA, including this protein. In...

B. What Is the Best Type of Marketing Research? Primary Presearch Primary research is the place...

B. What Is the Best Type of Marketing Research? Primary Presearch Primary research is the place you gather information yourself straightforwardly from the source. For instance, your business is thinking about adding another help to praise a current one and you have to build up a showcasing system. Online Surveys Surveys admirably for getting data from many individuals. They can mention to you what extent of respondents feel a specific way or offer a particular trademark and can be an...

Question