Question

In: Biology

Can you find any mutation, name the domains, if the proteins are conserved, and the amino...

Can you find any mutation, name the domains, if the proteins are conserved, and the amino acid sequences and in which organelle will you find the genetic material that encodes your genes.

>Pseudo-nitzschia multiseries (the homolog of the osteroccus tauri)

ATGTCTCAATCTGTATCAGAACGGACTCGAATTAAAAGTGACCGTTACGAATCTGGTGTAATCCCTTACG

CTAAAATGGGTTACTGGGATGCTTCATACACAGTAAAAACTACTGATGTTCTTGCTTTATTCCGTATCAC

ACCACAACCAGGCGTAGATCCTGTTGAAGCTGCTGCTGCAGTAGCTGGTGAATCTTCAACAGCAACTTGG

ACAGTTGTATGGACTGATTTATTAACAGCTTGTGATCGTTACCGAGCTAAAGCTTACCGTGTAGATCCAG

TTCCAAATACATCTGATGTTTTCTTTGCTTTCATCGCATACGAATGTGATTTATTCGAAGAAGGTTCTTT

ATCTAACTTAACAGCATCTATTATTGGTAACGTATTCGGTTTCAAAGCTGTATCAGCTTTACGTTTAGAA

GACATGCGTATTCCTCACTCATACTTAAAAACATTCCAAGGTCCTGCAACAGGTATCGTTGTAGAACGTG

AACGTTTAAATAAATATGGTGCTCCTTTATTAGGTGCTACAGTAAAACCAAAATTAGGTTTATCTGGTAA

AAACTACGGTCGTGTAGTATTCGAAGGTTTAAAAGGTGGTTTAGACTTCTTAAAAGATGATGAGAACATT

AACTCTCAACCATTCATGCGTTGGAGAGAGCGTTTCTTAAACTGTATGGAAGGTATTAACCGTGCATCTG

CTGCTACAGGAGAAGTAAAAGGTTCTTACTTAAACGTTACAGCTGCTACTATGGAAGAAGTAATCAAACG

TTGTGAGTACGCTAAAGAAGTAGGTTCTGTTATCGTTATGATCGATTTAGTTATGGGTTATACAGCTATT

CAATCTGCTGCTTACTGGGCTCGTGAAAACGATATGCTTTTACACTTACACCGTGCTGGTAACTCTACAT

ATGCACGTCAAAAAAACCATGGTATTAACTTCCGTGTAATTTGTAAATGGATGCGTATGTCTGGTGTAGA

TCATATCCACGCTGGAACAGTTGTAGGTAAATTAGAAGGTGATCCTTTAATGATTAAAGGTTTCTACGAT

ACTTTACGTTTAACTCATTTAGAAGTTAATTTACCATACGGTATTTTCTTCGAAATGCCTTGGGCTAGTT

TACGTCGTTGTATGCCAGTAGCATCTGGTGGTATTCACTGTGGTCAAATGCACCAATTAATTCACTACTT

AGGTGATGACGTAGTATTACAATTCGGTGGTGGTACAATTGGTCACCCTGATGGTATCCAAGCCGGTGCT

ACAGCTAACCGTGTTGCTTTAGAAGCAATGGTATTAGCTCGTAACGAAGGTGCTGATTTCTTCAGTAACG

AAGTTGGTCCTCAAATCTTACGTAATGCTGCTAAAACATGTGGTCCATTACAAACTGCATTAGATTTATG

GAAAGATATTAGTTTTAACTACACATCTACAGATACAGCTGATTTCGCTGTAACACCAACTGCAAACGTA

TAA

Expert Solution

There is no mutation in the given nucleotide sequence.
Upon blasting the protein we found that it belongs to Pseudo-nitzschia. The nucleotide of the given sequence codes for Ribulose 1/5 bis phosphate Carboxylase/oxygenase large subunit which is exclusively found in the chloroplast.

Since chloroplast makes its won ribulose 1/5 bis phosphate Carboxylase/oxygenase which means that the chloroplast genome has the coding region for ribulose 1/5 bis phosphate Carboxylase/oxygenase gene

gladiator answered 1 year ago

If a mutation prevented the synthesis of any of the linker proteins, what step(s) in meiosis...

If a mutation prevented the synthesis of any of the linker proteins, what step(s) in meiosis would not occur? Why is / are that step(s) important?

Is it possible for naturally produced proteins to have different functions without any change in amino...

Is it possible for naturally produced proteins to have different functions without any change in amino acid sequence or nucleotide sequence? How?

Amino acids are the building blocks of proteins, and can act as both a Brønsted acid...

Amino acids are the building blocks of proteins, and can act as both a Brønsted acid and a Brønsted base through intramolecular proton transfer (see Chapter 16, pg. 709 of the textbook). The simplest amino acid known is glycine, NH2CH2CO2H (Ka = 4.5 ×10–3 and Kb = 6.0 ×10–5 ), and it can exist in three forms in equilibrium with one another: H2N––CH2––COOH +H3N––CH2––COOH +H3N––CH2––COO– H2N––CH2––COO– Glycine cation zwitterion anion (a) Write the equilibria corresponding to Ka and Kb of...

How do you find the pH of any amino acid at a particular pH. Please explain...

How do you find the pH of any amino acid at a particular pH. Please explain the basics clearly. I am completely lost. Thanks

Understand how proteins that regulate the cell cycle can be altered (due to DNA mutation) and...

Understand how proteins that regulate the cell cycle can be altered (due to DNA mutation) and may lead to cancer (uncontrolled cell division). Know the role of tumor-suppressor genes and proto-oncogenes (genes are DNA segments).

Glycine residues occur in a higher percentage in proteins than any other amino acid. Suggest two reasons...

Glycine residues occur in a higher percentage in proteins than any other amino acid. Suggest two reasons why.

1. Name one amino acid that can replace glutamine in a protein without the likelihood of...

1. Name one amino acid that can replace glutamine in a protein without the likelihood of causing a functional effect on the protein? Explain your answer.

a) Name all the epimeric pairs you can find in these diastereoisomers. At what positions are...

a) Name all the epimeric pairs you can find in these diastereoisomers. At what positions are they epimeric? Using any two of these diastereoisomers as examples, name their enantiomers and anomers. D-allose, D-altrose. D-mannose, D-glucose, D-gulose, D-galactose, D-talose, D-idose b) Using any two of these diastereoisomers as examples, name their enantiomers and anomers.

if you can not find a commercial solid powder for any one of the chemicals above...

if you can not find a commercial solid powder for any one of the chemicals above can you explain why it is not available? did you find any suspicious product offering?

Find an example of application of Hypothesis testing that you can relate to (any example would...

Find an example of application of Hypothesis testing that you can relate to (any example would be OK using Z test you can consult HW Batch No. 4 or textbook). Show all five steps of Hypothesis testing with numerical example (you can use fictitious numbers if you have to). And find the P-Value and re-affirm Step 4 with P-Value.