Question

In: Biology

Based on the documentary " evolution What darwin never knew" answer the following questions in at...

Based on the documentary " evolution What darwin never knew" answer the following questions in at least 3 sentences each.

1. Why were the Galapago islands so important in darwin's discoveries?

2. Summarize Darwin's discoveries in relation to the behavior and physical characteristics of animals in the Galapagos. Provide at least 2 examples.

3. What was the importance of embryos in the studies of the evolution of species?

4. Explain the concept of natural selection using terms like adaptation and mutation. Provide at least two examples.

5. In what way do mutations in the DNA help explain the variation of the species. Provide at least two examples.

6. What is the importance of genes in the evolution of species?

Solutions

Expert Solution

1. The Galapagos island is located away from the mainland and is isolated.These are a group of islands with different environmental conditions. The species in their underwent changes faster to survive giving rise to variations and adaptation. Darwin observed these things and arrived at his theory.

2. Species undergo the process of natural selection. According to theory of natural selection , the species with better adaptation is selected for mating and their children are born. Adaptation is the changes a species acquire in their lifetime. The species which is better adapted to survive and compete in their environment gets naturally selected.

Examples are Marine Iguana and Finch.

3. Studying embryos tell us a lot about evolution. The growth in embryo involves the shedding of unwanted body parts such as vestigial organs. Human embryo had tail and when it grew, it eventually disappeared. This tells us the relationship we have with apes who have tail.

4. Natural selection is the process by which an organism is better adapted to the environment and are able to survive and produce more babies. Adaptation is the changes in behavior or physical an organism undergoes to better cope with the environment. Mutation is a change in gene that causes physical or behavioral changes. Due to these changes , a species having better advantages over other species is being selected naturally. Examples are Marine iguanas which adapted to the marine food habitat conditions and learned to swim. And finches with better adapted beak to scaveng prey from hard wood.

5. Mutation in DNA can cause very different behavior changes or physical changes. This can have tremendous impact on the survival of that species. For example in humans , a mutation causes HIV resistance. So, this human can survive better than the other humans without this mutation in a condition where everyone is infected by HIV. Also another example is a mutation which causes sickle cell anaemia in humans. This is a disease and the ones with this mutation has less chance than humans without it to survive.

6. Genes are very important in the evolutionary process. All the characteristics and adaptation are transferred to the next generation of offspring in this single tiny thing called gene. So, its pretty much very important.


Related Solutions

Watch the documentary on “Daughters of Mother India”. Based on the documentary, answer the following questions...
Watch the documentary on “Daughters of Mother India”. Based on the documentary, answer the following questions using your own thoughts. Be sure to give thorough explanations for your answers and reasoning. You must write at least 5 or more sentences for each question. Please write your answers in the spaces provided after each question. Write a brief summary on the documentary. What was it about? Who are the main characters? What important events took place? What is the message being...
1) What was the hidden mechanism of evolution that Darwin knew nothing about? 2) What specifically...
1) What was the hidden mechanism of evolution that Darwin knew nothing about? 2) What specifically changed in the DNA of the dark colored pocket mice? 3) Why do some fruit fly species Not have dark wing spots, even though they have the paint brush gene.
Please answer the following questions 4. Charles Darwin is responsible for discovering which of the following...
Please answer the following questions 4. Charles Darwin is responsible for discovering which of the following options a. the classification of living organisms b. the laws of inheritance c. the theory of natural selection d. All of them 5. The fact that the peoples of Africa generally have darker skin than peoples of Europe is due to; which of the following options a. Folic acid b. UV rays c. Vitamin D d. All of the above 6. Which of the...
Question (1) Answer each of the following questions briefly. These questions are based on the following...
Question (1) Answer each of the following questions briefly. These questions are based on the following relational schema: Emp(eid: integer, ename: string, age: integer, salary: real) Works(eid: integer, did: integer, pcttime: integer) Dept(did: integer, dname: string, budget: real, managerid: integer) (a) (5 points) Give an example of a foreign key constraint that involves the Dept relation. What are the options for enforcing this constraint when a user attempts to delete a Dept tuple? (b) (5 points) Write the SQL statements...
What do you think about the differences with regard to Lamarck's views of evolution and Darwin/Wallace's...
What do you think about the differences with regard to Lamarck's views of evolution and Darwin/Wallace's views?
Answer the following questions based on the reaction: K2CrO4 + AgNO3 ---> red solid. A: What...
Answer the following questions based on the reaction: K2CrO4 + AgNO3 ---> red solid. A: What is the formula for the solid produced? B: Using the reaction above, a chemestry student has 35 mL of a .250 M solution of silver nitrate. How many milliliters of .105 M K2CrO4 will be required to react completely with the silver ion present. C: Considering the reaction in part b, how many grams of product will be formed?
This questions are from Evolution class 1. In a short answer: What does the evidence point...
This questions are from Evolution class 1. In a short answer: What does the evidence point to as the ancestors of eukaryotes? How did eukaryotes form? Your answer 2. Mitochondria have their own Genes; in humans, only 13 genes. What is significant about this related to evolutionary origin of mitochondria AND why might be an ecological/evolutionary reason for there be so few mitochondrial Genes? 3. What is the principle of the selfish gene and how is our common way of...
Answer the following questions based on this codingstrand of DNA:                               &nbs
Answer the following questions based on this codingstrand of DNA:                                                                         5’ GGCCATGACAGAGGAGCAAAAGTTATTGCT 3’ Drennan et al. (1996) identified several mutations in this enzyme that result in methylmalonic acidemia (MMA). One of those mutations is a C to A at base pair 1904 in the coding strand of DNA (bold and italicized in the template strand). Write the unique coding strand of DNA for this patient and highlight the change you made. Write it 5’ to 3’. Write the mRNA sequence...
Please answer all questions. 6. If tropomyosin is never moved off actin, what would be the...
Please answer all questions. 6. If tropomyosin is never moved off actin, what would be the result? 7. If you died, why would you develop rigor mortis? 8. All of the motor units in the fingers were very large (many muscle fibers per motor unit. How would this affect function? 9. If the calcium (Ca++) pumps did not function how would this affect muscles?
"The Terri Schiavo Case." Based on your analysis of the case, answer the following questions: What...
"The Terri Schiavo Case." Based on your analysis of the case, answer the following questions: What are the major ethical issues involved in the case? Do you agree or disagree with the outcome of the case? Why or why not? Who should be eligible to legally make healthcare decisions to save or end life in the absence of an advanced directive? Why or why not? What should be the considerations when making a decision to discontinue life support? How can...
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT