Question

In: Economics

Write down your answers to the following question and upload a scanned copy of your answer...

Write down your answers to the following question and upload a scanned copy of your answer on blackboard (e.g. using the Adobe Scan App on your phone). Only PDF documents will be accepted.

Suppose the long-run production function of Curry’s brewing company is given by: Q = 3K0.25L0.75.

  • K is the total operating hours of all brewing machines and L is the total working hours of all workers.
  • Q is the number of beers produced per day.
  • The current rental rate (r) is $25/hour, wage rate (w) is $15/hour.

Part A: Production in the long run.

Find out the company’s optimal combination of labor & capital input (K*, L*) at Q = 300 in the long run. Keep two decimal places for your answers.

e). What is the firm’s total cost at the optimal input combination in the long run? (4 pts)

Part B: Production in the short run.

Suppose the long-run production function of Curry’s brewing company is still given by: Q = 3K0.25L0.75. Please answer the following questions and keep two decimal places for your answers.

f). In the short run, the firm’s number of brewing machine (K) is fixed at 16 units ( = 16). Write an equation for the short-run production function for the firm showing output as a function of labor (L). (4 pts)

g). Given short-run production function for the firm you derived in g), how many units of labor (L) will the firm need to use to produce 300 units of output (i.e., Q = 300)? (4pts)

h). Suppose the current rental rate is still $25/hour and the wage rate is still $15/hour in the short run. What will be the total cost of producing 300 units of output in the short run? Compare your answer in e), how much money will the firm save by using this optimal input combination in the long run? (6 pts)

Solutions

Expert Solution

Conclusions:

Part A: Long run production

The company’s optimal combination of labor & capital input at Q = 300 units in the long run is:

K* = 29.90

L* = 149.53

e.) Total cost at the optimal combination in the long-run is: $2990.45

Part B: Short run production

f.) Short run production function showing output as a function of labor is:

Q = 6L0.75

g.) The company required labor units = 184.20 in the short run to produce 300 units of output.

h.) Total cost in the short-run = $3163

e.) Money saved by using optimal combination in the long run = $172.55


Related Solutions

Use the R script to answer the following questions: (write down your answers in the R...
Use the R script to answer the following questions: (write down your answers in the R script with ##) (1). Import FarmSize.csv to Rstudio. Use the correct function to build a linear regression model predicting the average size of a farm by the number of farms; Give the model a name (e.g. FarmSize_Model). Call the model name to inspect the intercept and slope of the regression model. Verify the answers in your manual calculation. (2). Use the correct function to...
Use the R script to answer the following questions: (write down your answers in the R...
Use the R script to answer the following questions: (write down your answers in the R script with ##) (1). Import FarmSize.csv to Rstudio. Use the correct function to build a linear regression model predicting the average size of a farm by the number of farms; Give the model a name (e.g. FarmSize_Model). Call the model name to inspect the intercept and slope of the regression model. Verify the answers in your manual calculation. (2). Use the correct function to...
Using your knowledge of DNA replication, copy the following. Write down all the important steps and...
Using your knowledge of DNA replication, copy the following. Write down all the important steps and players of the reaction. Show the primer location and derive the complimentary strand sequence. 5` - AGATTCTGAGTCGTGACTCGTACGTCATAACTT -3`
Please Answer This question and write in your own words. Don't copy from any other resources....
Please Answer This question and write in your own words. Don't copy from any other resources. Thank you Busy Sally Socialite has trouble remembering people's birthdays, so she has organised her friends into what she calls a Birthday Support Team, or BST. Each friend needs only to keep track of three items of information: their own birthday (which of course they do not need to write down), the name of someone whose birthday comes earlier in the year than their...
Prepare a skills audit for yourself. Ask yourself the following questions and write down your answers....
Prepare a skills audit for yourself. Ask yourself the following questions and write down your answers. What are the skills you wish to develop? How are you going to develop them? What action needs to be taken? What time frame is required? Select one of the development skills which you have identified and develop a professional development program that will provide the necessary training. Document your plan (220–250 words) and provide reasons for the professional development strategies you have chosen.
Answer each question. Type question and answer, provide a cited rationale for your answers. Answer the...
Answer each question. Type question and answer, provide a cited rationale for your answers. Answer the following questions using the discussion board: • What is Orthostatic Hypotension? • Name the Chain of Infection • How do you collect data about pain from your patients? • Name the types of isolation precaution. and why I choose these answer
Answer all the items. To submit your exam you can either upload the file or upload...
Answer all the items. To submit your exam you can either upload the file or upload images of the pages with the handwritten answers (take photos or scan them). 1. T / F In double entry accounting, recorded financial events/transactions are self-balancing with debits equaling credits. 2. Fill out the basic accounting equation: ___________________ = _________________________ + ____________________ 3. Make the accounting entries for payment of medical supplies of $250. ACCT Debit Credit ______________ ___________ ___________ ______________ ___________ ___________ 4....
Answer the following questions. Your answers should address all parts of the question and be approximately...
Answer the following questions. Your answers should address all parts of the question and be approximately 300-400 words each. Make sure to thoroughly support all answers with accurate details and relevant evidence from the textbook and other resources. Search the Internet and find a company that offers medical professional liability (MPL) policies in your state for your area of practice. Provide a link to the company. Summarize their available coverage and limits of coverage. What optional coverage is available for...
Plz write in your own text and don't copy answers that was answered before since my...
Plz write in your own text and don't copy answers that was answered before since my teacher has (Plagiarism checker) thank you at least 3-4 paragraphs 1. What is a prepaid expense? Why does a company have to make this adjustment? What other adjusting entries do a company need to make for a period before preparing financial statements? 2. Why it important to reconcile the bank statement? What are some of the items involved in the reconciliation process? What do...
Plz write in your own text and don't copy answers that was answered before since my...
Plz write in your own text and don't copy answers that was answered before since my teacher has (Plagiarism checker) thank you In 800 APA word discuss one STD and its effect on life no Plagiarism
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT