Question

In: Biology

1a)Describe the structure of the flu virus capsid and the type of nucleic acid enclosed within...

1a)Describe the structure of the flu virus capsid and the type of nucleic acid enclosed within the capsid. What else is contained in the capsid?

1b) How does the flu virus replicate its genome?

Solutions

Expert Solution

The flu virus also known as Inluenza virus is typically spherical,with a diameter of 80-120 nm but pleomorphism is common.The virus core consists of ribonucleoprotein in helical symmetry.The negative sense single stranded RNA is segmented and exists as 8 pieces.The nucleocapsid is enveloped which has an inner membrane protein layer and outer lipid layer.The membrane protein consists of two components M1 and M2.Protein part of the envelope is virus coded and the lipid layer is derived from modified host cell membrane.There are two types of spikes projecting from the envelope: hemagglutinin and neuraminidase peplomers.

Within the capsid is the single stranded RNA which is segmented and exists as 8 pieces.RNA dependant RNA polymerase is also present which helps in the transcription of viral RNA in the host cells.

Replication of Viral genome:

The virus enters the host cells and bind to the glycoprotein or glycolipid receptors on the host with the help of the spikes.Later the virus changes the shape and fuses with the endosomal membrane of the host.In the host nucleus the virus undergoes primary transcription and produces proteins and the enzymes required for the replication.This is followed by the synthesis of 8 positive complementary sense RNA strands from negative sense RNA segments.A negative sense RNA is produced from this cRNA which is transported to the cytoplasm of the host cell.The virus particles are then assembled to form complete viruses.


Related Solutions

Describe the function of carbohydrates, lipids, nucleic acids, and proteins in the structure of a virus.
Describe the function of carbohydrates, lipids, nucleic acids, and proteins in the structure of a virus.
Hepatitis B Virus: 1. Describe the viral architecture 2. Nucleic acid composition 3. Enveloped or non-enveloped?...
Hepatitis B Virus: 1. Describe the viral architecture 2. Nucleic acid composition 3. Enveloped or non-enveloped? 4. Host(s)? How does the virus gain entrance to host? 5. Mode of transmission(s)? 6. Organ System(s) affected? 7. Symptoms of viral disease. 8. Treatments? 9. Acute or persistent infection and why?
Describe the structure of the COVID-19 virus
Describe the structure of the COVID-19 virus
Which single-stranded nucleic acid could form a hairpin structure? Select one: a. 5’ TTTGCGATACTCATCGCATT 3’ b....
Which single-stranded nucleic acid could form a hairpin structure? Select one: a. 5’ TTTGCGATACTCATCGCATT 3’ b. 5’ TTTGCGATACTCACACTATT 3’ c. 5’ TTTGCGATACTCTGCGATTT 3’ d. All of the sequences above could form a hairpin loop. e. None of these sequences could form a hairpin loop.
1a. Describe the steps of how the pathogen (the Powassan virus) reproduce virons. 1b. What would...
1a. Describe the steps of how the pathogen (the Powassan virus) reproduce virons. 1b. What would be different if it were negative sense? *Please answer and explain both parts of the question!! but more importantly part b!!!*
1a. Draw and describe the differences in the carbohydrates on O, A and B type blood....
1a. Draw and describe the differences in the carbohydrates on O, A and B type blood. (That is, the antigens H, A and B.) b. Explain to a pre-diabetic why foods high in starch are not ideal for their medical condition when, “they do not taste sweet.”
What is the Spike protein found in the SARS-CoV-2 virus? Describe the structure of the S...
What is the Spike protein found in the SARS-CoV-2 virus? Describe the structure of the S protein (quaternary, tertiary, secondary and primary protein layers). Also highlight key domains and features of the structure of the S-protein that are important for its function.
Describe the general structure of a virus, indicating what features all viruses have and what features...
Describe the general structure of a virus, indicating what features all viruses have and what features are unique to certain viruses. What controls the tropism of a virus?
1. A certain cell type produces acid within the stomach. Name the cell and explain why...
1. A certain cell type produces acid within the stomach. Name the cell and explain why these cells are not destroyed by acid they make. 2. You went to your favorite eatery and ordered the most expensive steak. While eating the delicious steak, a piece accidentally entered into your trachea instead of the esophagus. Explain how this event would affect your blood pH?
PLEASE TYPE OUT YOUR WORK 1A)Explain the difference between primary, secondary, tertiary, and quaternary structure of...
PLEASE TYPE OUT YOUR WORK 1A)Explain the difference between primary, secondary, tertiary, and quaternary structure of proteins, including similarities and differences in hydrogen bonding of EACH STRUCTURE WITH ONE ANOTHER 1 B) Distinguish between parallel and antiparallel BETA-sheets 1C) which kinds of forces stabilize proteins at different levels of structure, i.e., what stabilizes secondary structure, what causes protein chains to fold into tertiary structure, what holds oligomers together? 1D) which bonds can rotate in proteins, and WHAT ARE the names...
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT