How do nucleotides form a double helix?

How do nucleotides form a double helix? Give details Explaination

Expert Solution

Nucleotides don't form a double helix. Single strands of DNA form a double helix, and single strands of DNA are made by nucleotides.

Explanation:

Nucleotides are monomers that make up the polymer called DNA. DNA is a single strand of nucleotides that are linked together. If you have a complementary strand (meaning a strand of DNA that can basepair to the first strand...G:C, A:T), then these two strands can form a double helix.

Nucleotides don't form a double helix. Single strands of DNA form a double helix, and single strands of DNA are made by nucleotides.

khuku guchhait answered 2 years ago

The following is a sequence of nucleotides in a DNA double helix that codes for a...

The following is a sequence of nucleotides in a DNA double helix that codes for a short polypeptide. The messenger RNA encoded by this DNA has both translational initiation and termination codons. STRAND A: T T T A G T T A T C A A T C T T G G G T A G A A C STRAND B: A A A T C A A T A G T T A G A A C...

Hydrogen bonds can form with bases on the opposite DNA strands in the double helix, or...

Hydrogen bonds can form with bases on the opposite DNA strands in the double helix, or between the bases and H2O in the single stranded conformation. Considering that the double helix is the most stable conformation in water, how does this observation support the conclusion that base stacking contributes more to helix stability than interbase hydrogen bonding?Hydrogen bonds can form with bases on the opposite DNA strands in the double helix, or between the bases and H2O in the single...

What is the difference between double helix, triple helix and quadriplex structure in in nucleic...

What is the difference between double helix, triple helix and quadriplex structure in in nucleic acid molecules? How are these formed? Which one is most stable and why? Can they contribute in DNA origami where you can make nano structures like cube boxes, etc.

What are nucleotides? How do nucleotides contribute to genes and chromosomes? Why is the trinucleotide sequence,...

What are nucleotides? How do nucleotides contribute to genes and chromosomes? Why is the trinucleotide sequence, CAG, important in Huntington Disease?

Name the three components of a DNA nucleotide. Explain how the DNA double helix is formed...

Name the three components of a DNA nucleotide. Explain how the DNA double helix is formed including the Base Pairing rules and the Antiparallel structure.

RNA polymerases interact with specific sections of the DNA double helix in a genome. Mention how...

RNA polymerases interact with specific sections of the DNA double helix in a genome. Mention how those DNA portions are called and all you know about their structure. You will also mention which other types of proteins interact with the DNA and RNA polymerase and how they help control gene expression.

The term "double helix" as it is used to describe DNA refers to the the fact...

The term "double helix" as it is used to describe DNA refers to the the fact that DNA is comprised of 2 DNA strands that are twisted together to form a spiral. True False The genotype ratio compares the number of times each genotype would be produced in the offspring of a mating. True False If one strand of a segment of DNA has a base sequence of A-G-C-A-T, its complementary strand would be T-C-G-T-A. True False t RNA: carries...

Describe the 3 structures the DNA double helix could exist in.

The following sequence of 30 nucleotides corresponds to one of the two strands of a double...

The following sequence of 30 nucleotides corresponds to one of the two strands of a double stranded DNA: 5’ GATGTGATCAGACCGGGTGCACTCTAATCT 3’ a) This sequence has two perfect palindromes that consist of 6 base pairs each. What is the sequence of these two palindromes? b) Show both strands of your FIRST palindrome (indicate the 5’-3’ polarity) c) Show both strands of your SECOND palindrome (indicate the 5’-3’ polarity) Assume that the two palindromes are recognized by “6-cutter” restriction enzymes, and that...

( This is the 3 topic for question 1) DNA is a double-stranded helix, DNA and...

( This is the 3 topic for question 1) DNA is a double-stranded helix, DNA and RNA are polymers of nucleotides, DNA replication depends on specific base pairing 1) Post three topics or quotes that you found interesting from chapter 10, and explain why. Also respond to at least three other classmates using the 3C+Q method. 2) Name three changes that you could make to decrease your ecological footprint. 3) What can we do to preserve and restore biodiversity? 4)...

Question