How do nucleotides form a double helix?

How do nucleotides form a double helix? Give details Explaination

Solutions

Expert Solution

Nucleotides don't form a double helix. Single strands of DNA form a double helix, and single strands of DNA are made by nucleotides.

Explanation:

Nucleotides are monomers that make up the polymer called DNA. DNA is a single strand of nucleotides that are linked together. If you have a complementary strand (meaning a strand of DNA that can basepair to the first strand...G:C, A:T), then these two strands can form a double helix.

Nucleotides don't form a double helix. Single strands of DNA form a double helix, and single strands of DNA are made by nucleotides.

khuku guchhait answered 2 years ago

Next > < Previous

Related Solutions

Hydrogen bonds can form with bases on the opposite DNA strands in the double helix, or...

Hydrogen bonds can form with bases on the opposite DNA strands in the double helix, or between the bases and H2O in the single stranded conformation. Considering that the double helix is the most stable conformation in water, how does this observation support the conclusion that base stacking contributes more to helix stability than interbase hydrogen bonding?Hydrogen bonds can form with bases on the opposite DNA strands in the double helix, or between the bases and H2O in the single...

What is the difference between double helix, triple helix and quadriplex structure in in nucleic...

What is the difference between double helix, triple helix and quadriplex structure in in nucleic acid molecules? How are these formed? Which one is most stable and why? Can they contribute in DNA origami where you can make nano structures like cube boxes, etc.

What are nucleotides? How do nucleotides contribute to genes and chromosomes? Why is the trinucleotide sequence,...

What are nucleotides? How do nucleotides contribute to genes and chromosomes? Why is the trinucleotide sequence, CAG, important in Huntington Disease?

Name the three components of a DNA nucleotide. Explain how the DNA double helix is formed...

Name the three components of a DNA nucleotide. Explain how the DNA double helix is formed including the Base Pairing rules and the Antiparallel structure.

The term "double helix" as it is used to describe DNA refers to the the fact...

The term "double helix" as it is used to describe DNA refers to the the fact that DNA is comprised of 2 DNA strands that are twisted together to form a spiral. True False The genotype ratio compares the number of times each genotype would be produced in the offspring of a mating. True False If one strand of a segment of DNA has a base sequence of A-G-C-A-T, its complementary strand would be T-C-G-T-A. True False t RNA: carries...

Describe the 3 structures the DNA double helix could exist in.

The following sequence of 30 nucleotides corresponds to one of the two strands of a double...

The following sequence of 30 nucleotides corresponds to one of the two strands of a double stranded DNA: 5’ GATGTGATCAGACCGGGTGCACTCTAATCT 3’ a) This sequence has two perfect palindromes that consist of 6 base pairs each. What is the sequence of these two palindromes? b) Show both strands of your FIRST palindrome (indicate the 5’-3’ polarity) c) Show both strands of your SECOND palindrome (indicate the 5’-3’ polarity) Assume that the two palindromes are recognized by “6-cutter” restriction enzymes, and that...

( This is the 3 topic for question 1) DNA is a double-stranded helix, DNA and...

( This is the 3 topic for question 1) DNA is a double-stranded helix, DNA and RNA are polymers of nucleotides, DNA replication depends on specific base pairing 1) Post three topics or quotes that you found interesting from chapter 10, and explain why. Also respond to at least three other classmates using the 3C+Q method. 2) Name three changes that you could make to decrease your ecological footprint. 3) What can we do to preserve and restore biodiversity? 4)...

TRUE OR FALSE To enable replication of DNA the double helix needs to be opened forming...

TRUE OR FALSE To enable replication of DNA the double helix needs to be opened forming replication forks

The enzyme that unwinds the DNA double helix is called DNA gyrase c. helicase primase

The enzyme that unwinds the DNA double helix is called DNA gyrase c. helicase primase d. ligase RNA polymerase has 5’- 3’ exonucleases 3’- 5’ exonucleases both exonucleases no exonucleases In the synthesis of RNA the addition proceeds by attack of the 3’OH to the a phosphate of the incoming NTP attack of the 3’OH to the a phosphate of the incoming dNTP attack of the 5’OH to the a phosphate of the incoming NTP attack of...

Subjects