Question

In: Biology

mention examples of homeostasis. Explain what this process is and show examples of processes in the...

mention examples of homeostasis. Explain what this process is and show examples of processes in the body which show homeostasis. For example, blood sugar levels or body temperature.(reference needed)

Solutions

Expert Solution

What is Homeostasis?

The ability to keep a stable internal environment within the cell or a body is called Homeostasis.

Examples of Homeostasis :

1) Control of Body Temperature :

In humans normal body temperature is around 37 degrees celcius. The body temperature regulation is controlled by hypothalamus in the brain. Feedback about body temperature is carried to the brain through bloodstream which in return results in adjustments of breathing rate, metabolic rate.

2) Blood sugar levels :

The basic form of sugar in human body is glucose which is directly used by the body. The human body has to maintain proper sugar levels to ensure a person remains healthy. If the glucose levels are high the Pancreas release insulin and if it is low the liver converts glycogen into glucose and maintains its level.

3) Maintenance of blood pressure :

Whenever the blood pressure increases the heart senses it and sends signals to the brain. The brain sends appropriate feedback signals back to the heart and the heart slows down decreasing its pumping. If the blood pressure is too low the heart speeds up.

4) Maintenance of calcium levels in blood :

Whenever calcium levels decreases in the blood stream parathyroid releases hormones and makes it available in proper amounts. And when it's too low, thyroid secretions fixes the bone calcium and Lowers the blood calcium levels.

Please rate if you like the answer. Thank you!


Related Solutions

Mention what System Quality has been implemented and done in your company, show the process and...
Mention what System Quality has been implemented and done in your company, show the process and how it works
Directions: Identify the restriction sites for each of the examples given. Show the cuts, mention if...
Directions: Identify the restriction sites for each of the examples given. Show the cuts, mention if they are sticky ends or blunt, 5’ overhangs or 3 ‘overhangs and the number of DNA fragments produced and the number of base pairs in each (count the top row).             Remember: Analyze in the 5’à 3’ direction 1. HindII --- 5' GTC ↓GAC 3' 5' ACGACGTAGTCGACTTATTAT GTCGACCCGCCGCGTGTCGACCATCA 3' 3' TGCTGCATCAGCTGAATAATACAGCTGGGCGGCGCACAGCTGGTAGT 5' Number of pieces of DNA _______ 2. EcoRI --- 5' G ↓AATTC...
Explain your understanding of the purpose and process of primary homeostasis following an incision.
Explain your understanding of the purpose and process of primary homeostasis following an incision.
Explain in paragraph format Explain franchising with examples. Mention the advantages and disadvantages associated with franchising....
Explain in paragraph format Explain franchising with examples. Mention the advantages and disadvantages associated with franchising. How is franchising different from licensing?
show that if {X (t), t≥ 0} is a stochastic process with independent processes, then the...
show that if {X (t), t≥ 0} is a stochastic process with independent processes, then the process defined by Y (t) = X (t) - X (0), for t≥ 0, has independent increments and Y(0)=0
Explain the consumer-adoption process, and explain the five adopter groups (mention if you agree with that...
Explain the consumer-adoption process, and explain the five adopter groups (mention if you agree with that segmentation and why).
Explain 5 examples of how increasing or decreasing surface area aids the body to maintain homeostasis...
Explain 5 examples of how increasing or decreasing surface area aids the body to maintain homeostasis or to function. Each example should be from a different organ system. Identify the organ system of each of your examples.
Explain 5 examples of how increasing or decreasing surface area aids the body to maintain homeostasis...
Explain 5 examples of how increasing or decreasing surface area aids the body to maintain homeostasis or to function. Each example should be from a different organ system. Identify the organ system of each of your examples.
explain the homeostasis of glucose in blood
explain the homeostasis of glucose in blood
Explain the three levels in the planning process and give an example for each. Also mention...
Explain the three levels in the planning process and give an example for each. Also mention how they are linked with each other and why planning is important for each of the three levels of management.
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT