Question

In: Accounting

1. List examples of manufacturing and non-manufacturing costs for the following manufacturing companies (One product was...

1. List examples of manufacturing and non-manufacturing costs for the following manufacturing companies (One product was chosen per company).

Write : Direct Material (2 or more), Direct Labor (1 or more if applicable), Manufaturing Overhead (3 or more); Non-Manufacturing (3 or more) for each product and company

a. Company: Hewlett-Packard. Product: printers

b. Company: KDD. Product: Cooking Cream

c. Company: Nike. Product: Training shoes

Solutions

Expert Solution

DIRECT MATERIAL-Direct Material are those materials which are used in the production of the the product and which are directly identified with the product

DIRECT LABOUR-Direct Labours refers to wages and salaries which are directly attributed to a specific finished product.

MANUFACTURING OVERHEAD-It is all indirect cost which are incurred during the production of a product.This overhead is applied to the unit produced within a reporting period

NON MANUFACTURING OVERHEAD- Itis a overhead that are incurred outside of a company's manufacturing operations.These are generally called as Selling,General and Administrative Expenses.

COMPANY PRODUCT DIRECT MATERIAL DIRECT LABOUR MANUFACTURING OVERHEAD NON MANUFACTURING OVERHEAD
Hewlett-Packard Printers

1)Plastics

2)Glass Filled Polyamide

1)Working hours

2)Overtime working hours

3)Payroll taxes

4)Medicare

1)Lighting and Heating Cost

2)Property taxes, 3)Insurance 4)Depreciation of the Company's Asset

1)Bad Debts

2)Audit and legal fees

3)Corporate Salaries

KDD Cooking cream

1)Milk

2)Sugar

1)Workers working hours and overtime working hours

2)Employment insurance

1)Salaries of maintenance staff

2)Property taxes,

3)Lighting and Heating Cost

1)Interest on business Loan

2)Marketing and Advertisement

3)Supplies for the offices

Nike Training shoes

1)Leather

2)Cotton

1)Working hours

2)Employment insurance

3)Workers overtime hours worked

1)Production supervisor salary

2)Rent and Rates

3)Repair and Maintenance

1)Marketing and Advertisement

2)Bad Debts

3)Interest on BusinessLoan

plz upvote if u find the solution to be helpful


Related Solutions

Identify the different types of product (manufacturing) and non-production costs. In addition, describe the changes in...
Identify the different types of product (manufacturing) and non-production costs. In addition, describe the changes in composition of total manufacturing costs during the last century
b. List and explain the characteristics of product differentiation. Provide 3 examples of companies actually using...
b. List and explain the characteristics of product differentiation. Provide 3 examples of companies actually using this technique and the impact of that differentiation had on the firms’ performance.
3.Identify the different types of product (manufacturing) and non-production costs. In addition, describe the changes in...
3.Identify the different types of product (manufacturing) and non-production costs. In addition, describe the changes in composition of total manufacturing costs during the last century.
please select a product that you can use and list some of the manufacturing costs (direct...
please select a product that you can use and list some of the manufacturing costs (direct material, direct labor, variable factory overhead, and fixed factory overhead). Indicate which would be included in the cost of goods sold under variable and absorption costing.
Examples in my notes usually provided scenarios with manufacturing companies so finding costs is quite straight...
Examples in my notes usually provided scenarios with manufacturing companies so finding costs is quite straight forward, like direct material costs etc. Then my homework asked for costs examples in the context of an insurance company and i got confused as insurance is not like manufacturing where there are physical products. Please help so i can get a better understanding on this. and also what would be the cost objects in this case. Thanks you so much.
20)Product costs: 1. include only the prime costs of manufacturing a product. 2. include only the...
20)Product costs: 1. include only the prime costs of manufacturing a product. 2. include only the conversion costs of manufacturing a product. 3. are expensed when products become part of finished goods inventory. 4. are regarded as assets before the products are sold. 5. exclude fixed factory overhead. 21)Dividends in arrears: 1. Must be disclosed in the notes to the financial statements. 2. Must be reported in the liabilities section of the balance sheet. 3. Are expenses that are reported...
10-bb. List and explain the characteristics of product differentiation. Provide 3 examples of companies actually using...
10-bb. List and explain the characteristics of product differentiation. Provide 3 examples of companies actually using this technique and the impact of that differentiation had on the firms’ performance. Relatively Large Number of Sellers- Not Price Makers- No collusion- Easy Entry and Exit- Economies of scale- Non-Price competition Independent action- Differentiated Products- Please help me in explaining the characteristics above.
(1) Please list examples of fixed costs, variable costs, and mixed costs incurred by (your choice...
(1) Please list examples of fixed costs, variable costs, and mixed costs incurred by (your choice - choose one business) a McDonald’s restaurant, (2) a law firm, OR 3) a construction company. List at least one example of each type of cost. Also, please identify the activity base (driver) for each variable cost. (2) DBR Manufacturing rewards the company’s plant manager with a year-end bonus based on the increase in the plant’s operating income. For purposes of determining the manager’s...
Differentiate between product costs and period costs. Give concrete examples of product costs and period costs...
Differentiate between product costs and period costs. Give concrete examples of product costs and period costs What are the 3 classes of manufacturing costs? Give concrete examples for each. Explain variable, fixed, and mixed costs and give concrete examples of each.
1.Why are non-covalent bonds important in biological systems? List at least three examples of non-covalent interactions....
1.Why are non-covalent bonds important in biological systems? List at least three examples of non-covalent interactions. 2. You want to amplify at least the underlined sequence, you can have some flanking sequence as well.       5’CTGCTACGTACTGGATGACTGACTGTGATGATCTGATCCCAGTGCTCGTAGTCGTGCGTTCGTAATATATAGCGATGGCGCGATGCGATGCGCGTAGCGGCTAGGCGTAGGCGGATTCGGCTAGGCGATGGCGATGGCGATGCGATATTCTAGCGCTAGCGATGAGGTGATTATATCGGCGCTAGCTGATCGTAGCTGATCG 3’ Design the most optimal primers according to Tm and length. Write out each primer and show which is the 5’ and 3’ end of each primer. How big will your PCR product be? 3.. What are the differences between covalent bonds and non-covalent...
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT