Question

Natasha was certain she was looking younger despite her 58 years on this Earth. Every day in the mirror her lines seemed to disappear. She had searched so long for something to slow the process of aging; her marriage depended on it! Vladimir would never stay with her if he saw the wrinkles she did! Even her precious parrot, Bruno, had noticed and shied away from her! She could never live without him so she tried it all: mercury creams, Botox, weight pills from the ancient woman in the south side market of Moscow, Switzerland’s best cell therapy, and one pint of honey and another of yogurt every day!

But a week or two after her “youth” came back she wasn’t feeling nearly so good…. Finally she went to the hospital because her fever was so high (102.8). She also had a non-stop horrible cough, muscle aches, vomiting, diarrhea, and a terrible headache. As the attendant physician at the hospital you try to narrow it down based on the patient profile, potential exposures and symptoms.

What are the top five suspects for Natasha’s infectious disease? Justify your choices. (10 points)

You send off for some laboratory tests right away and find the information below. Explain these results. Does this change your diagnosis? If so how? (6 points)

Leukocytes – 6,000,000,000/L

Platelets – 700,000/ L

RBC – 450,000,000/L

Hb – 14g/dL

HCT% - 49

Bilirubin – 6 mg/dL

Creatinine – 0.97 mg/dL

Natasha’s cough got worse and worse and the clock seemed to be ticking. The results of the molecular and immunological panel are below. Has your reasoning been confirmed? Interpret them and describe how they work. (12 points)

Western immunoblotting (first lane ladder, second Natasha’s blood, third positive control, fourth negative control)

LPS - 240 KDa

83149 antigen - 208 KDa

FlaA - 99 KDa

rRT-PCR

What is this organism doing in Natasha’s body to cause disease? (pathogenesis, virulence factors, detail) (15 points)

How did Natasha’s innate immune system try to protect her from the infection? (make sure it is specific for this type of attack) (10 points)

Please describe the acquired immune reaction that occurred in response to this infection. (make sure it is specific for this type of attack) (20 points)

What treatment would you prescribe after confirming your original diagnosis? How does each part of that treatment work? (6 points)

You sent off a sample for sequencing in order to aid in prescribing the proper treatment and got the following sequence back:

TGGATTATGCGATGTCGGTCATTTTGGACCGGGCTTTGCGCATATCGCAGACGGTTTAAAGCCCGTCCAGCGTCGAATCGTGTACGCCATGTCAGAATTGGGTTTAAAATCAACCGCTAAGTATAAGAAATCAGCGCGGACGGTAGGCGACGTTTTGGGTAAATTCCATCCGCACGGAGACACCGCCTGTTACGAGGCCATGGTATTGATGGCCCAACCTTTTTCATTTCGCTATCCCTTTGTCGATGGGCAAGGCAATTGGGGGAGCGCGGATGATCCC AAATCCTTTGCCGCCATGCGTTATACGGAAGCACGTCTG

Describe the complete process, step by step, that this protein plays a role in. (6 points)

Use an online tool to transcribe and translate the sequence and paste below. Describe how that would be done inside the cell of the pathogen in detail. (10 points)

E.coli has a glutamine at position 87 in this protein. Our pathogen has a glycine. Speculate on how this affects the organism and it’s ability to cause/maintain/spread disease in humans. Give molecular detail. (5 points)

Answer 1

As explained above that Natasha was worried about her skin aging and she used botox injections and mercury creams, these twi things have severe side effects, which made Natasha ill. Below are the side effects of both botox and mercury cream.

1. Botox (onabotulinumtoxinA) is an injectable neuro-toxin used for the treatment of chronic migraines, strabismus, and blepharospasm. Side effects of Botox include:-

   •   allergic reactions

   •   rash

   •   itching

   •   headache

   •   neck or back pain

   •   muscle stiffness

   •   difficulty swallowing

   •   shortness of breath

   •   nausea

   •   diarrhea

   •   stomach pain

   •   loss of appetite

   •   muscle weakness

   •   injection site reactions including

   •   bruising

   •   bleeding

   •   infection

   •   fever

   •   cough

   •   sore throat

   •   runny nose

   •   flu

Side effects caused by elemental mercury on skin:-

   •   mood swings, nervousness

   •   insomnia

   •   headache

   •   abnormal sensations

   •   weakness

   •   muscle atrophy

   •   decreased cognitive functions.

And High exposures of elemental mercury can cause kidney malfunction, respiratory failure, and death.

So, as expalined these are the symptoms which are similar to the symptoms of Natasha , they are caused by botox and mercury cream.

ORGANISM THAT CAUSED NATASHA TO DISEASE

Total mercury was determined by the Cold Vapour Atomic Absorption Spectrophotometry using an automatic mercury analyser and hydroquinone by High Performance Liquid Chromatography. The mean concentration of total mercury in skin toning creams and cosmetic soaps observed were 0.098 ± 0.082 and 0.152 ± 0.126 ?g/g, respectively. The mean concentration of hydroquinone was 0.243 ± 0.385 and 0.035 ± 0.021 % in skin toning creams and cosmetic soaps, respectively. All the creams and soaps analysed had mercury and hydroquinone levels below the US Food and Drug Administration, which is not at allacceptable to the limit of 1 ?g/g and 2 %. The low levels of mercury and hydroquinone in the creams and soaps analysed in this study.