Question

In: Computer Science

Using ERP software, one can cut down on data duplication by keeping all your information within...

  1. Using ERP software, one can cut down on data duplication by keeping all your information within _______ cohesive system.

    multiple

    silo

    one

    departmental

1 points   

QUESTION 2

  1. Epicor ERP’s strengths include the amount of data it can store and analyze, as well as the automation it can provide when it comes to __________.

    customers

    vendors

    supply chain management

    production

1 points   

QUESTION 3

  1. Modern ERP practices began in the 1990s due to the rise of computer software being integrated with daily business____________.

    requirements

    costs

    operations

    expenditures

1 points   

QUESTION 4

  1. This is any ERP software which is deployed directly on your in-site devices.

    Open Source ERP

    On-premise ERP

    Cloud-based ERP

    Hybrid ERP

1 points   

QUESTION 5

  1. Odoo is a(n) _________ ERP and CRM used by over 4 million users worldwide.

    simple

    open-source

    limited

    closed

1 points   

QUESTION 6

  1. ERP communication tools organize scanned documents, files, emails, texts, and phone call recordings.

    True

    False

1 points   

QUESTION 7

  1. Microsoft is been a leader in the ERP software market for many years through its ________ product offerings.

    Iron Mountain

    Great Plains

    Solomon

    Dynamics

1 points   

QUESTION 8

  1. With SAP HANA, one doesn’t need to take the time to load data from your transactional database into your reporting database, or even build traditional tuning structures to enable that reporting.

    True

    False

1 points   

QUESTION 9

  1. Benefits of ERP Software include all except:

    Low implementation costs

    Streamlined workflows and processes

    Visibility into workflows

    Better financial planning and decision making

1 points   

QUESTION 10

  1. It is important to use an industry-specific ERP solution because:

    a general ERP system will weigh you down with unnecessary features

    a specialized ERP system will weigh you down with unnecessary features

    an industry-specific ERP system will cost less

    a general ERP system will cost more

1 points   

Solutions

Expert Solution

Question 1;

The answer is ONE.

Using ERP software, one can cut down on data duplication by keeping all your information within ONE cohesive system.

Question 2

The answer is Production/ manufacturing.

Epicor ERP’s strengths include the amount of data it can store and analyze, as well as the automation it can provide when it comes to PRODUCTION.

Question 3

The answer is Operations

Modern ERP practices began in the 1990s due to the rise of computer software being integrated with daily business OPERATIONS.

Question 4

The answer is On- premise ERP

This is any ERP software which is deployed directly on your in-site device. That is On-Premise ERP.

Question 5

The answer is open-source

Odoo is an OPEN-SOURCE ERP and CRM used by over 4 million users worldwide.

Question 6

The answer is True

YES, ERP communication tools organize scanned documents, files, emails, texts, and phone call recordings.

Question 7

The answer is Dynamics

Microsoft is been a leader in the ERP software market for many years through its DYNAMICS product offerings.

Question 8

The answer is True

YES, With SAP HANA, one doesn’t need to take the time to load data from your transactional database into your reporting database, or even build traditional tuning structures to enable that reporting.

Question 9

The answer is Visibility into workflows

Question 10

The answer is an industry-specific ERP system will cost less

It is important to use an industry-specific ERP solution because: an industry-specific ERP system will cost less.

Hope I am clear with the answers provided to you. hope you understand. It would be great if you can provide a positive rating.

And in case of any douts or misunderstanding in the solution provided, please leave a comment, I will be available to clear them as soon as possible. Thank you.


Related Solutions

Check your worksheet by changing the variable selling cost in the Data area to $900, keeping all of the other data the same as in Exhibit 1–7.
This Excel worksheet form is to be used to recreate Exhibit 1–7. The workbook, and instructions on how to complete the file, can be found in Connect. Required: 1. Check your worksheet by changing the variable selling cost in the Data area to $900, keeping all of the other data the same as in Exhibit 1–7. If your worksheet is operating properly, the net operating income under the traditional format income statement and under the contribution format income statement should...
Steganography is the technique of hiding secret messages/information within other non-secret data/information. One popular way of...
Steganography is the technique of hiding secret messages/information within other non-secret data/information. One popular way of steganography is hiding text (plaintext) within images (cover text). Each image is a collection of pixels, where each pixel is typically represented by 3 values (RGB). Each of R, G, and B is a value between 0 and 255 and thus can be represented by 8 bits. The color of the pixel depends on these values. However, if the least significant bit (last bit...
Using your knowledge of DNA replication, copy the following. Write down all the important steps and...
Using your knowledge of DNA replication, copy the following. Write down all the important steps and players of the reaction. Show the primer location and derive the complimentary strand sequence. 5` - AGATTCTGAGTCGTGACTCGTACGTCATAACTT -3`
Using the library, Internet, and your course materials, research information about software development methodologies. Select at...
Using the library, Internet, and your course materials, research information about software development methodologies. Select at least 3 different development methodologies. Write 400–600 words to address the following: Provide a brief description for each of your selected methodologies. Include at least 3 characteristics of each methodology Discuss the advantages and disadvantages of each methodology Cite all references using APA formatting. Create a table to summarize your findings, as follows:
Excel can provide data analysis when you need to evaluate multiple conditions within one formula. One...
Excel can provide data analysis when you need to evaluate multiple conditions within one formula. One such example includes using nested statements. Someone might attempt to explain nested statements to a friend by giving the example of a Russian nesting doll, wherein different pieces of the function fit together to create one formula that yields a specific result. There is a learning principal that states that being able to explain a topic to someone using non technical terms or an...
Write down all the food items you consume in one complete day. Assemble information from food...
Write down all the food items you consume in one complete day. Assemble information from food labels, menus, and dietary tables to calculate the number of grams of proteins, carbohydrates, and fats consumed. Calculate the number of Calories in each food type using 4 Cal/g for proteins and carbohydrates and 9 Cal/g for fats. Then obtain information about recommended dietary requirements for persons of your sex, age, weight, height, and level of activity from health or biology teachers or the...
Please show complete work and all calculations Using the following information for a population of data...
Please show complete work and all calculations Using the following information for a population of data points X : n=30 =5   2 =4 ( population variance) A) What is the distribution of the population of sample means? B) Find the probability that the sample mean is less than 4 ?
Instructions:  Read the information below.  Provide a print screen of your work when using a software tool. Adbul...
Instructions:  Read the information below.  Provide a print screen of your work when using a software tool. Adbul is the new maintenance supervisor at a local manufacturing plant. He is responsible for the maintenance of machinery for production line processes.  Abdul is interested in the level of machine failures. He would like to simulate the number of machine failures each month.  Using historical date, Abdul established the probability of failures during a month as follows: Number of Machine failures Probability 1 0.10 2 0.17...
Using the data provided in the excel file, show all of your work for the following...
Using the data provided in the excel file, show all of your work for the following calculations: a.) mean temperature of unmixed reagents (oC) b.) δελταT from graph (oC) c.) q absorbed by reaction mixture (J) d.) q absorbed by calorimeter, stirrer, and thermometer (J) e.) q total absorbed (J) f.) q total released (J) g.) calculation to show limiting reagent h.) deltaH neutralization for the reaction (kJ/mole of acid) A student reacted 100.0 mL of 0.9800 M HCl with...
please write all formulas and show your work without using excel Using the information in Question...
please write all formulas and show your work without using excel Using the information in Question 1, what is the break-even market size for the project? Show your work, and round to the nearest unit. Refer to question 1: Consider a project with annual expected income based on approximately $125 million in revenue and approximately $77.5 million in total variable cost. You realize that both of these numbers are projected, and that your projections may be incorrect. Your boss wants...
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT