Question

In: Finance

a. At what point, do you start to lose money?1) Create a covered write position

Use the information in the table to answer the following questions. Create one spread per question from the prices in the chart. Create only one option spread for each question. For example, if you were going to create a covered write you might want to buy 100 shares at $91 and write a May 100 call against it. Please use a different option than the example.

Calls Puts

May – 85

$7.50

May – 85

$1.50

May – 90

$4.20

May – 90

$3.10

May – 95

$1.90

May – 95

$5.90

May – 100

$0.75

May – 100

$9.80


a. At what point, do you start to lose money?1) Create a covered write position

b. At what point to you make a maximum profit? What happens if the stock continues to increase?

c. Is this a low or high volatility spread? What does volatility mean?

Solutions

Expert Solution

In my entire life, I have not heard a term like covered write. Not sure what it means in this question. It will be either Write a covered call or write a covered put. Not sure what covered write means.

--------------------------

From the example give it seems, the question refers to: Write a covered call.

Hence, lets proceed with a covered call as:

  • Buy 100 shares @ 91
  • Write a May-95 Call option. Each call option will be on 100 shares.

Hence, the profit / (Loss) will be: N x [(S - S0) - max (S - K, 0) + C] = 100 x [(S - 91) - max (S - 95, 0) + 1.90]

Let's now make the profit / (Loss) table for the entire range of S:

S Profit / (Loss)
             -                    -8,910.00
      20.00                  -6,910.00
      40.00                  -4,910.00
      80.00                     -910.00
      85.00                     -410.00
      89.10                         -0.00
      90.00                         90.00
      95.00                      590.00
    100.00                      590.00
    110.00                      590.00
    120.00                      590.00
    130.00                      590.00
    140.00                      590.00
    150.00                      590.00
    160.00                      590.00
    170.00                      590.00
    180.00                      590.00

Part (a)

We start losing money as soon as the stock price falls below 89.10

Part (b)

The maximum profit is made at a stock price of 95 (same as the strike price of the call option selected)

The profit is remains constant even if the stock price continues to rise.

Part (c)

Covered call is a low volatility spread. It is likely to result into profits if stock price reamins rangebound within the strike price of the call.

Volatility means dispersion from the mean. It means how much stock prices deviate from their average. Lower voltaility means higher stability in prices and the returns.


Related Solutions

Do you start new projects (such as college) with great enthusiasm, only to lose motivation along...
Do you start new projects (such as college) with great enthusiasm, only to lose motivation along the way? How can you keep you motivation strong?
At what point does commercialization start to create inequality? Please provide examples.
At what point does commercialization start to create inequality? Please provide examples.
You inherit $1000 from your Mother. 1) What do you do with the money? What do...
You inherit $1000 from your Mother. 1) What do you do with the money? What do you spend it on? Do you save any of it? 2) Calculate your MPS and MPC. Show your work. 3) Calculate your Multiplier.    Show your work. 4) What effect does your spending have on GDP - how much additional spending is credited?
Explain what is meant by a "covered call". How does one create a covered call? What...
Explain what is meant by a "covered call". How does one create a covered call? What must be purchased or sold? Why might someone want to do this? How would you calculate the profit?
1) Suppose you start at a point and every minute you flip a coin. If the...
1) Suppose you start at a point and every minute you flip a coin. If the coin is head you move 1 foot north. If it is tails you stay in the same spot. A) At n minutes, what is the exact probability distribution of the number of feet north you have moved. B) What is the standard deviation of the number of feet you have moved. C) After 2000 minutes what is the approximate probability you have moved between...
How do we create money? What is government spending multiplier?
How do we create money? What is government spending multiplier?
Why do you think banks usually don't lend money to start-ups?
Why do you think banks usually don't lend money to start-ups?
1. Explain what money is and how banks create it.
1. Explain what money is and how banks create it.
A) The +1 start of transcription is at position 52 of the following sequence. If the...
A) The +1 start of transcription is at position 52 of the following sequence. If the top strand is the coding strand, and the bottom strand is the template strand, write out the transcribed RNA sequence. 5' TACCGAGAGAGGTTGACAAATGCCTAGATTGATGATTATA 3' 3' ATGGCTCTCTCCAACTGTTTACGGATCTAACTACTAATAT 5' 0000000001111111111122222222233333333334 1234567890123456789012345678901234567890 5' TAATTCGGATGAGAGGGTTCAGGACAAGCTTTAGCCCTAT 3' 3' ATTAAGCCTACTCTCCCAAGTCCTGTTCGAAATCGGGATA 5' 4444444445555555555666666666677777777778 1234567890123456789012345678901234567890 (Write the sequence of nucleotides from the start site to the end without spaces or any other characters, just a string of RNA nucleotides)
What do you think the patient have Schizophrenia or Bipolar? (Worth an extra point) 1 point...
What do you think the patient have Schizophrenia or Bipolar? (Worth an extra point) 1 point that you can add to any assignment Assessment: Included at least 3 Subjective and Objective Date- Diagnosis: Give me 3 Mental Health Nursing Diagnosis Outcomes: Give me 3 Expected Outcomes with measurable goals Planning: Give me 3 interventions, 1 must be evidence-based Implementation: Give me 3 ways you implemented the plan Evaluation: Give 3 ways you evaluated the care plan
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT