Question

In: Biology

A ______________________ is a “lawn” of plated bacteria indicates the presence and activity of wild-type bacteriophage...

A ______________________ is a “lawn” of plated bacteria indicates the presence and activity of wild-type bacteriophage that have undergone recombination.

ANSWERS:

plaque

lysogenic colony

lytic phage

a lytic colony

none of these choices are correct

Solutions

Expert Solution

Answer - plaque

- lysis of a bacteriophage infected cell of bacteria indicates the plaque, it is just the clear area found within the lawn of bacteria.the area of plaque won't increase with deprived nutrient conditions. that is , with low nutrients the recombinant wild type bacteriophages activity will be less, hence plaque can be used as the indicator.

- lysogenic colony refers to a group of phages that can integrate  DNA of phage in susceptible bacteria, followed by the passing of phage DNA to the next generations of bacteria. As the presence of wild type bacteriophage is not indicated in this colony, it is not the answer.

- The lytic colony refers to a group of phages that can cause the replication of DNA of phage in susceptible bacteria, followed by release of new phages by the lysis of the cell. they won't indicate the presence of wild type bacteriophage, hence not the answer.

-lytic phage, are those who can induce the lysis of the bacterial cells. as they are not lawn of plated bacteria, it is not the answer.

As plaque is the answer, last option is incorrect.


Related Solutions

Explain the process by which a single microscopic bacteriophage can produce a plaque in a lawn...
Explain the process by which a single microscopic bacteriophage can produce a plaque in a lawn of bacteria that is visible to the naked eye: infection, replication etc.
Describe the pattern in a line graph that indicates the presence of an interaction effect in...
Describe the pattern in a line graph that indicates the presence of an interaction effect in a factorial design.
´does the presence of coliform bacteria mean that the water is unsafe, or at least a...
´does the presence of coliform bacteria mean that the water is unsafe, or at least a definite pathological risk?
1. The presence of protein in the urine indicates which of the following? Select one: A....
1. The presence of protein in the urine indicates which of the following? Select one: A. damage to the renal tubules B. damage to the filtration membrane C. too much protein in the diet D. high levels of transcription and translation by the bodies tissues Question 2 Adipose tissue is one of the most hydrated of all tissues in the human body. Select one: True False Question 3 The path urine takes after it is formed until it leaves the...
A blood test indicates the presence of a particular disease 96​% of the time when the...
A blood test indicates the presence of a particular disease 96​% of the time when the disease is actually present. The same test indicates the presence of the disease 0.8​% of the time when the disease is not present. Two percent of the population actually has the disease. Calculate the probability that a person has the​ disease, given that the test indicates the presence of the disease.
Why is the type of bacteria in the urine as important as the amount of bacteria...
Why is the type of bacteria in the urine as important as the amount of bacteria ?
1) The widespread success of chains such as Buffalo Wild Wings and Wingstop indicates consumer demand...
1) The widespread success of chains such as Buffalo Wild Wings and Wingstop indicates consumer demand for Buffalo wings is substantial and growing. Buffalo wings, of course, have nothing to do with buffalos—they are fried chicken wings coated in various types of generally hot sauces. How does the increase in demand for Buffalo wings affect the costs of a restaurant like Chick-fil-A, which does not sell them but sells sandwiches made from chicken breasts? 3) The managers of the Glenmorangie...
Which of the following types of bacteria can survive and grown in the presence of oxygen....
Which of the following types of bacteria can survive and grown in the presence of oxygen. CHECK ALL THAT APPLY Aerotolerant Microaerophiles Facultative Anaerobes Obligate Anaerobes Obligate Aerobes
At Wild Sports Corp., the selling price per unit for lawn mowers is $120, variable cost...
At Wild Sports Corp., the selling price per unit for lawn mowers is $120, variable cost per unit is $55. Fixed costs are $130,000. Contribution Margin per unit is? $65 $75 $175 $30 Salaries of the maintenance workers, janitors, and security guards will be treated as ____________. Indirect labor cost Direct labor Factory overhead cost Conversion cost You have a job paying $1,500 per month in your hometown. You have a job offer in a neighboring city that pays $2,000...
Which of the following sequences indicates the presence of a rho-independent (intrinsic) transcriptional terminator? A. TGATTTTTTTCGCATTTTAACGAAACGCGCTGCAAAAAAAATTATA...
Which of the following sequences indicates the presence of a rho-independent (intrinsic) transcriptional terminator? A. TGATTTTTTTCGCATTTTAACGAAACGCGCTGCAAAAAAAATTATA B. TGAAAAACGACAAGCAGCGCGAAACGCGCTGCAAAAAAATTATA C. TGAAAAACATCGCATTTTAACGAAACGCGCTGCATTTATTTTTTTT D. TGAAAAACGACAAGCAGCGCGAAACGCGCTGCATTTATTTTTTTT
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT