Question

In: Biology

3) Using the gene symbols from the table below, give the genotype(s) for the following phenotypes:...

3) Using the gene symbols from the table below, give the genotype(s) for the following phenotypes: white flower, round seeds, and yellow seeds.

Table 1. Characters and traits for Mendel’s pea plants.

Character

Dominant Trait

Gene Symbol

Recessive Trait

Gene Symbol

Flower color

Purple

P

White

p

Seed color

Yellow

Y

Green

y

Seed shape

Round

R

Wrinkled

r

Monohybrid cross

4) You are attempting to re-create some of Mendel’s experiments. You love your plants so much that you give them names. In your garden, one plant, Jenny, is pollenated by another plant, Johnny (peas have perfect flowers, so even though we are assigning them a single sex, they technically are both male and female). Jenny is homozygous dominant for purple flowers and Johnny has white flowers. In order to figure out what kind genotypes and in what ratios their offspring will be, you will construct a Punnett square. To do this, list ALL possible gamete types for Johnny and Jenny. Remember that gametes are haploid and therefore only have one copy of each allele!

5) Place the gametes you generated in 4) in the top row for Johnny and left column for Jenny of the Punnett square below. Then copy and paste the Punnett square below into your lab write up.

Johnny’s gametes

                 

                                          Jenny’s gametes

6) What are the genotypic ratios expected for the offspring of the cross? In other words, how many of each genotype (homozygous dominant, homozygous recessive, heterozygous) are there? List the gene symbols and corresponding number for each genotype.

7) What are the phenotypic ratios expected for the offspring of the cross? In other words, how many of each phenotype (purple, white) are there?

8) You plant some of Johnny and Jenny’s offspring. Two in particular become your favorite plants and you name them Jamie and Josie. You decide to cross these two plants together (you can cross siblings in plants, but this is not really something that occurs very often in humans for various reasons!). Place the gametes that would result from meiosis in Jamie and Josie in the top row for Jamie and left column for Josie of the Punnett square. Then copy and paste the Punnett square below into your lab write up.

                                                                                    Jamie’s gametes

                 

                                          Josie’s gametes

9) What are the genotypic ratios expected for the offspring of the cross?

10) What are the phenotypic ratios expected for the offspring of the cross?

Solutions

Expert Solution

Starting with what is homozygous and heterozygous . Homozygous means a gene with same Alleles . So homozygous fominant will be a pair of dominant alleles . So for flower color homozygous dominant is PP.

Homozygous recessive is ,allele pair with both revessive alleles so it will pp for flower color .

Heterozygous means the allele pair has one dominanant allele and one recessive allele . So for flower color it will be Pp. Now in Heterozygous condition the dominant allele and trait are expressed . So for a flower with genotype Pp , phenotype will be purple . The dominant P causes purple here by supressing the white color of p allele which is Recessive.

Ans 4.

Parents - homozygous dominant × homozygous recessive.

- PP x pp

Gametes - Johnny - P. And jenny - p

F1-

Johny ----> P P

Jenny

p Pp Pp
p Pp Pp

All offsprings are heterozygous and purole flowered.

Genotypic ratio - Pp :Pp: Pp: Pp

So 1:1:1:1

Phenotype - all 4 - purple so phenotypic ratio is 1:1:1:1.

Ans 7-

F2- Pp. X Pp

P p
P PP Pp
p Pp pp

Genotypic ratio - PP: Pp : pp

So 1:2:1

Now , phenotypic ratio - purple : white

So 3:1.

If this helps please give it a positive rating thank you!


Related Solutions

3. Listed below are the phenotypes of the offspring from a pizza self fertilization experiment regarding...
3. Listed below are the phenotypes of the offspring from a pizza self fertilization experiment regarding the traits of toppings and crust thickness. Yeah that’s right, in my dream world pizza can self fertilize. AND THEN I EAT IT ALL. offspring phenotype # of offspring cheese, thin crust 67 veggie delight, thin crust 22                cheese, thick crust 197 veggie delight, thick crust 64 What is the dominant phenotype for pizza toppings? OK. So, in looking at these data, do you...
Supposing shell color in scallops is controlled by a single gene. Using appropriate symbols that you...
Supposing shell color in scallops is controlled by a single gene. Using appropriate symbols that you specify, please explain the following results by providing four Punnett Squares. Give a short explanation of your logic as needed. a. yellow shells X black shells produce ½ yellow offspring + ½ black offspring b. black shells X black shells produce 100% black offspring c. orange shells X orange shells produce ¾ orange offspring + ¼ black offspring d. yellow shells X orange shells...
Give an example from your own life of one of each of the following: Passive genotype-environment...
Give an example from your own life of one of each of the following: Passive genotype-environment correlation Reactive genotype-environment correlation Active genotype-environment correlation Negative genotype-environment correlation
Table 3 (below) shows annual returns for the S&P 500 for the years 2000-2016: Table 3:...
Table 3 (below) shows annual returns for the S&P 500 for the years 2000-2016: Table 3: Annual Returns Year Returns 2000 -9.0% 2001 -11.9% 2002 -22.0% 2003 28.4% 2004 10.7% 2005 4.8% 2006 15.6% 2007 5.5% 2008 -36.6% 2009 25.9% 2010 14.8% 2011 2.1% 2012 15.9% 2013 32.2% 2014 13.5% 2015 1.4% 2016 11.7% Calculate: The cumulative return over the 17 years; The average annual return; The standard deviation; The Sharpe Ratio (assuming a risk free rate of 2.3% on...
Using correct “fly” notation, write the genotype of the following flies. 1) Genotype 1: homozygous for...
Using correct “fly” notation, write the genotype of the following flies. 1) Genotype 1: homozygous for yellow body and heterozygous for vestigial wings             2) Genotype 2: homozygous for wild type for body color and wing veins and homozygous recessive for vermillion eye color. 3) Genotype 3: homozygous wild type for everything, a single symbol will cover this. GENES ONLINE 4) Would this person have the disease? _________ 5) What is the basis for your prediction?
. Give the predicted phenotypes for the F1-generation resulting from a dihybrid cross of the haploid...
. Give the predicted phenotypes for the F1-generation resulting from a dihybrid cross of the haploid gametes originating from the diploid parents, RRtt x rrTT, in the Punnett Square below. In each square, choose colony colour (red or white) and growth / no growth on MIN (+ or -) from the drop-down menus. Also choose the correct the genotypes of the haploid gametes. The RRtt parent gives rise to the mating type “alpha” gametes and the rrTT parent forms “a”...
1. The given mRNA sequence is transcribed from the gene below it. 5’ AGCUUCGAACUCAUGCAGGGCCACCCGAUUACCAUGUAAGUUACGCA 3’ 3’...
1. The given mRNA sequence is transcribed from the gene below it. 5’ AGCUUCGAACUCAUGCAGGGCCACCCGAUUACCAUGUAAGUUACGCA 3’ 3’ TGAAGCATATTAGTACCGATGTCGAAGCTTGAGTACGTCCCGGTGGGCTAATGGTACATTCAATGCGT5’ 5’ ACTTCGTATAATCATGGCTACAGCTT CGAACTCATGCAGGGCCACCCGATTACCATGTAAGTTACGCA 3’ Within the double-stranded DNA above: a. Which strand ( top / bottom ) is the coding strand? b. Circle the -10 promoter element. c. Underline a single nucleotide indicating the transcription start site. d. Circle the translation start and stop codons. e. What is the amino acid sequence encoded by the mRNA given? Don’t forget that there is always...
3. Chapter 3: Using the table below, calculate the following: MAD, MSE, MAPE. What do you...
3. Chapter 3: Using the table below, calculate the following: MAD, MSE, MAPE. What do you conclude? Period Demand Predicted 1 129 124 2 194 200 3 156 150 4 91 94 5 85 80 6 132 140 7 126 128
Amino acid symbols and properties. Complete the table. Spend several minutes looking at Table 3-1 first....
Amino acid symbols and properties. Complete the table. Spend several minutes looking at Table 3-1 first. Then try to fill in the below by memory. Then try to remember those you forgot. The one and two letter codes are how parts of genome sequence are reported. You will need to understand this language to interpret these data, which are increasingly used in medicine and research. These symbols are used in many subsequent lecture as well. three letter symbol one letter...
For ALL problems, state hypotheses, in words and symbols and give me everything listed below. Use...
For ALL problems, state hypotheses, in words and symbols and give me everything listed below. Use SPSS when appropriate but DO NOT print out and turn in SPSS output.  Instead, just read the critical information out of SPSS and report: obtained t-statistic, probability of obtaining that statistic under the null (p-value), decision to reject null or not, interpretation of results in words, and report measure of effect size if appropriate. I want to know if rats with an exercise wheel in...
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT