Plot a dot matric using the sliding window 1 nucleotides long and setting up a stringency...

Plot a dot matric using the sliding window 1 nucleotides long and setting up a stringency threshold of 1 out 1 matches for putting a dot in the relevant element on the dot matrix. Draw a line on the dot matrix and write down the corresponding alignment between these two sequences.

AACTAGCCCCATGCAAGCATT

ACTAGCGCGCCTCATGCAGCATT

Expert Solution

Upload the images of the handwritten table for dot matrix and using the online parser:

venereology answered 11 hours ago

Design a 9th order low-pass filter with cut-off ??/ 2 using the Hanning window. a) Plot...

Design a 9th order low-pass filter with cut-off ??/ 2 using the Hanning window. a) Plot its frequency response. b) Express the Input/ Output relation. c) let ??[??] = { 0 ?????? ?? = 0,1,2…..,10 1 , ?????? ?? = 11,12,…..30 Calculate ?? = ?? ? ?. Plot and comment on the shape of y.

1.) Cytosine makes up 20% of the nucleotides in a sample of DNA from an organism....

1.) Cytosine makes up 20% of the nucleotides in a sample of DNA from an organism. What percent of the nucleotides in this sample will be thymine? A. 20 B. 30 C. 40 D. 80 E. it cannot be determined from the information given 2.) Which one of the following statements about DNA is incorrect? A. The amount of A in double stranded DNA is equal to the amount of G. B. The amount of purines in double stranded DNA...

QUESTION 2 a) Using a company of your choice, explain the implications of setting up an...

QUESTION 2 a) Using a company of your choice, explain the implications of setting up an accounting system in that particular company, further explain the considerations to be made for the purchase of the system and the benefits or otherwise of applying such a system in that company. Explain any five disadvantages of cost accounting in a business organization. b) What challenges are likely to be faced by the cost accountant in the establishment of the systems in your chosen...

You are setting up a PCR reaction using DNA from a bacteria with a genome size...

You are setting up a PCR reaction using DNA from a bacteria with a genome size of 17 megabase-pairs (mb). How many nanograms of DNA will you need to add to the reaction to ensure there are at least 100 copies of the single gene you are trying to amplify? (assume the average molecular weight of a nucleotide pair is 650). (2 pt)

What are 4 short-term measurable goals and four long-term measurable goals for setting up a diabetes...

What are 4 short-term measurable goals and four long-term measurable goals for setting up a diabetes clinic in a predominantly poor Hispanic neighborhood?

Using a long rod that has length μ, you are going to lay out asquare plot...

Using a long rod that has length μ, you are going to lay out asquare plot in which the length of each side is μ. Thus thearea of the plot will be μ2. However, you do notknow the value of μ, so you decide to make n independentmeasurements X1, X2, ..., Xn ofthe length. Assume that each Xi has mean μ(unbiased measurements) and varianceσ2.a. Show that x 2 is not an unbiased estimator for μ2.b. For what value k is the...

1. Using 3 nucleotides, adenine, guanine, and cytosine, illustrate why the sequence in DNA is read...

1. Using 3 nucleotides, adenine, guanine, and cytosine, illustrate why the sequence in DNA is read from 5’--------?3’. Draw the structures of the linked nucleotides to illustrate your answer. 2. Draw the structure of 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphoinositol. Using the drawing, illustrate the difference between saturated and unsaturated fatty acids: 16:0 and 18:1, n-9. 3. Discuss how the structure of the cell membrane regulates the passage of material in and out of the cell. To answer this question, list and draw the components...

You are setting up a relative trade between WTI and Brent using futures contracts. Your point of...

You are setting up a relative trade between WTI and Brent using futures contracts. Your point of view (POV) is that over the next week, Brent prices will increase less than WTI prices. How could you set up a trade using futures contracts to profit from your POV? (don’t worry about the # of contracts, just which would be long or short) You are setting up a timing trade using RBOB futures contracts. Your point of view is that over the next week,...

Directions 1. Start up IDLE3.8 and open a scripting window. 2. Write a program to solve...

Directions 1. Start up IDLE3.8 and open a scripting window. 2. Write a program to solve the following problem: functions - The program should input 3 integers, do calculations and print results. You need to write 4 functions for average, smallest, largest and middle as well as writing a main(). Use the main() for input, calling functions and output. Enter a number...6 Enter a number...2 Enter a number...11 Average = 6.33 Smallest = 2 Largest = 11 Numbers in order...

1.Which of the following would be classified as a product-level activity? A. Setting up a machine...

1.Which of the following would be classified as a product-level activity? A. Setting up a machine for a batch of a standard product. B. Operating a cafeteria for employees. C. Running the Human Resource department. D. Advertising a product. 2.The plant manager's work is an example of a: A.Unit-level activity. B.Batch-level activity. C.Product-level activity. D. Facility-level activity. 3.In activity-based costing, the activity rate for an activity cost pool is computed by dividing the total overhead cost in the activity...

Question