Select all of the following that are used to predict protein coding genes from a genome...

Select all of the following that are used to predict protein coding genes from a genome sequence

		ORF detection
		cDNA
		Codon Bias
		BLAST searches to identify similar DNA or protein sequences

Unique DNA sequences are harder to assemble when creating a whole genome sequence than repetitive DNA sequences

True

False

Solutions

Expert Solution

gladiator answered 3 months ago

Next > < Previous

Related Solutions

Describe three types of post-transcriptional regulation of protein–coding genes

Humans are almost identical in the protein-coding sections of the genome, yet each individual has a...

Humans are almost identical in the protein-coding sections of the genome, yet each individual has a unique DNA profile. Explain how this is possible.

Although mutations in the coding region of a genes can lead to changes in protein sequence...

Although mutations in the coding region of a genes can lead to changes in protein sequence (non-synonomous, nonsense, frameshift) there are plenty of mutations in non-coding regions within the genome that can alter how gene are expressed. In the scenarios below, please indicate what non-coding regions might contain a SNP (Single Nucleotide Polymorphism) mutation, and how this SNP mutation might lead to the given scenario: a. no transcription occurs for a particular gene b. Transcription occurs, but the mRNA is...

What phenomenon explains the following data? Virus 1 - 100 Kb genome, 99 Kb protein coding...

What phenomenon explains the following data? Virus 1 - 100 Kb genome, 99 Kb protein coding Virus 2 - 1 Mb genome, 998 Kb protein coding Bacterium 1 - 5 Mb genome, 4.9 Mb protein coding Bacterium 2 - 11 Mb genome, 10.8 Mb protein coding Plant - 5000 Mb genome, 15 Mb protein coding Fungus - 50 Mb genome, 11 Mb protein coding Grasshopper - 500 Mb genome, 18 Mb protein coding Snake - 1200 Mb genome, 19 Mb...

Name five common characteristics of protein-coding genes and the regions surrounding them. Why is prediction of...

Name five common characteristics of protein-coding genes and the regions surrounding them. Why is prediction of eukaryotic genes more complex than prediction of prokaryotic genes?

Question 8 [14 marks / 14 minutes] Design mutations of hypothetical protein-coding genes: a)Design a null...

Question 8 [14 marks / 14 minutes] Design mutations of hypothetical protein-coding genes: a)Design a null mutation where the site of the mutation is outside the Open Reading Frame (ORF).Explain how your mutation fits the definition of a null mutation. [5 marks] b)What type of mutagen could generate your null mutation? Explain.[2 marks] c)Design a mutation that is not a null allele. Explain the consequence of your mutation for thefunction of the protein. [5 marks] d)What type of mutagen could...

1A- Which of the following are possible functions of a protein (select all that apply)? A-Enzyme...

1A- Which of the following are possible functions of a protein (select all that apply)? A-Enzyme B-Trnasport C-Hormone D-Genetic Code 1B- During pyruvate oxidation, pyruvate is oxidized, forming Acetyl Coa. What is the bame of the stage of cellular respiration during which the pyruvate was generated, allowing for pyruvate oxidation to occur? A- Glycolysis B-Oxidative phosphorylation C-Substrate-level phosphorylation D- Chemiosmosis

1. Select known barriers to telemedicine. (select all that apply) A. It studies how genes can...

1. Select known barriers to telemedicine. (select all that apply) A. It studies how genes can be manipulated for better drug effect B. It studies genetic information looking for new targets for drugs C. It studies how genetic information determines drug allergies D. It studies how drugs affect genetic material 2.What tests/algorithms are shared between statistics and machine learning? A. Bayes, decision trees, neural networks B. Linear regression, logistic regression, neural networks C. Bayes, linear regression, logistic regression D. Linear...

1. Which of the following is the best description of a genome? a. All of the...

1. Which of the following is the best description of a genome? a. All of the genes of an organism b. A sequence of DNA bases that code for a particular protein c. A single molecule of DNA d. A duplicated chromosome formed by DNA replication 2. The end result of mitosis is a. two cells, each with half the number of chromosomes as the mother cell. b. two cells, each with twice the number of chromosomes as the mother...

Part A: The following sequence encodes a protein in the virus genome: 5’ tctaaaatgtcagatgtaaagtgcacatcagtagtcttactctcagttttgtaacaactc 3’ 3’...

Part A: The following sequence encodes a protein in the virus genome: 5’ tctaaaatgtcagatgtaaagtgcacatcagtagtcttactctcagttttgtaacaactc 3’ 3’ agattttacagtctacatttcacgtgtagtcatcagaatgagagtcaaaacattgttgag 5’ How many amino acids long is the protein? Part B: A base pair substitution (ie. a point mutation) that introduces a nonsense mutation could be introduced to the sequence encoding the protein in Part A. True/False

Subjects