Question

In: Economics

What is the sequence of events in the Relentless Profit Squeeze and compare to the sequence...

What is the sequence of events in the Relentless Profit Squeeze and compare to the sequence of events facing a monopoly

please answer soon anyone

Solutions

Expert Solution

A relentless profit squeeze starts with the event of increase in input prices, that leads to the event of rise in cost of production, but the price is sticky in nature in short run and due to still competition, profit margin squeezes. Again, the input price increase and rise in the cost of production, with further decrease in profit margin leading to the profit squeeze. The cycle of these events continues and profit keeps decreasing. It also happens for the competitive firm, when new firms join and supply increases and price decreases. It decreases the profit and if it is positive, then more firms join unless the profit squeezes to be zero economic profit in the long run. In contrast to it, a monopoly has no substitutes in the market and sets a price level if the firm is making economy of scale. It increases the market power of the monopoly firm that further increases the price up to the level to keep other firms out of the market. It makes monopolist to earn more profit and more power so that to set higher price again. This chain of events makes monopoly firm to continue earning higher profit.


Related Solutions

The following events occurred in April for Main Squeeze. A. You put $3,000 cash into the...
The following events occurred in April for Main Squeeze. A. You put $3,000 cash into the company and signed over your car (with a value of $5,000). In exchange the company issued 8,000 shares to you. B. Purchased a lemonade stand/trailer paying $600 cash on signing and financing the remainder with a loan over 5 years. The stand's purchase price is $6,000. C. Entered into a 5-year seasonal lease for prime boardwalk space with the city of saint john. Payments...
Compare the For Profit formats and reporting to the Not for Profit formats and reporting, what...
Compare the For Profit formats and reporting to the Not for Profit formats and reporting, what are some of the similarities and differences.
What is the sequence of events taking place in the plantar reflex, naming the sensory and...
What is the sequence of events taking place in the plantar reflex, naming the sensory and motor neurons, and the muscles involved in this reflex.
Compare to this DNA sequence: 1. Forward sequence: GAATAATTTAACTATTCTCTGTTCTACATGGGGAGCAGATTGGGTACCACCCAAGTATTGACTTACCCATCAACAACCGCTATGTATCTCGTACATTACTGCCAGCCACCATGAATATTGCACGGTACCATAAATACTTAACCACCTGTAGTACATAAAAACCCAATCCACATCAAAACCCCCTCCCCATGCTTACAAGCAAG
Compare to this DNA sequence: 1. Forward sequence: GAATAATTTAACTATTCTCTGTTCTACATGGGGAGCAGATTGGGTACCACCCAAGTATTGACTTACCCATCAACAACCGCTATGTATCTCGTACATTACTGCCAGCCACCATGAATATTGCACGGTACCATAAATACTTAACCACCTGTAGTACATAAAAACCCAATCCACATCAAAACCCCCTCCCCATGCTTACAAGCAAGTACAGCAATCAACCCTCAACTACCACACATCAACTGCAACTCCAAAGCCACCTCTCACCCACTAGGATACCAACAAACCTACCCACCCTTAACAGTACATAGTACATAAAGCCATTTACCGTACATAGCACATTACAGTCAAATCCCTTCTCGTCCCCATGGATGACCCCCCTCAGATAGGAAAACCCTTGACCAACCATCCTCCAGGGCCGAGGGTAATTTCTTTTGGTTTCATTCTAAAGGCACCATTGTGCGACTTTCTATTTGAACTCAAGGGCAGTTTCTTTATTCCTCTCCCTTTACTCTCGCATCCTTAAAGGAAAAGGAGGTTTCGAATTCCCCCCTGTCTAATTGTTAGAGCACACATAGGCGATCGTTCTATAACTCAGCACAAACCGGGGGGAAAAACATTTCATAGGGGCACTAAGTCTCGGATTCCCCATCTTCCCCCGGGGGCTGGGCGGGTAGCCCCTTGAAAACACTAGACCCTTCGGTGGTAAAAATTGCCTACAACCGAATTAAAAAATGAGAGCCGTTTTTCCTGGC Reverse sequence: ATTTTGAGGGGGCTTCTTGGGGGGCGAGTAGGATTGACTCGTGATGTGCTATGTACGGTAATGGCTTTATGTACTATGTACTGTTAAGGGTGGGTAGGTTTGTTGGTATCCTAGTGGGTGAGAGGTGGCTTTGGAGTTGCAGTTGATGTGTGGTAGTTGAGGGTTGATTGCTGTACTTGCTTGTAAGCATGGGGAGGGGGGTTTTGATGTTGGATTGGGTTTTTTATGTACTACAGGTGGTTAAGTATTTTATGGTACCGTGCAATTATTTCATGGGTGGCTGGGCAGTATTGTACGGAGATACCATAGCGGGTTGGTTGGATGGGGTAAAGTCATTAATTTGGGGTGGGTACCCCAAATCTGCTTCCCCCATGAAAAGAAACAGAGAATAAGTTTTAATTTTGGTTTCTTTAGCTTTGGGGTGCTTAATGGGGGGGAGGTTAAAAAACCCCCCCGCCGTTTCCCGGGGGGGGGGGGGGGGGCAACCTTCCCCGGGCCCGGGGGGAAAACTAACCCGTATGGACAGTCTTCCAATCACGTCAAAGTTTAGGTCTTTTTATATTACTTCAATGGGGCTGGGGGACGTTCGGGAAAACGGGTGACCCATTGGGGGGTTAATCACCTTGGGGGATAGTCCGGTGGGGGAGCTGGCCCAAGTGCCCAATATCAACGTGGTGACGGGGGGGTGGGGGGGGGGCGGTGGGGTCTCGAAA
List and describe the sequence of events for injection molding.
List and describe the sequence of events for injection molding.
2. List sequence of electrical cardiac events.
2. List sequence of electrical cardiac events.
What is the triple-alpha process? List the sequence of events that occur in this process. Does...
What is the triple-alpha process? List the sequence of events that occur in this process. Does this effect occur in all stars, or only high mass stars?
what is the sequence of events of skeletal muscle contraction, including stimulation by the nervous system,...
what is the sequence of events of skeletal muscle contraction, including stimulation by the nervous system, structure and role of myofilaments and calcium including where it is stored in the muscle and what causes its release. what role does energy play in muscle comtraction?
Number the events below 1 – 7 to represent the correct sequence of events in skeletal...
Number the events below 1 – 7 to represent the correct sequence of events in skeletal muscle contraction and relaxation ___Ca2+ binds to troponin; tropomyosin moves, exposing the active site of actin ___Acetylcholine (ACh) triggers an end-plate potential in the motor end plate. ___ The motor neuron stops releasing ACh and Acetylcholinesterase degrades the ACh in the synaptic cleft ___An Action potential in the sarcolemma travels down the T-Tubules ___ Ca2+ is released from the sarcoplasmic reticulum into the cytosol...
Compare the functions of the mooring sequence (C to U editing), the exon complementary sequence (A...
Compare the functions of the mooring sequence (C to U editing), the exon complementary sequence (A to I editing), and guide RNA (pan-editing).
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT