1. which of the following muscles originate on the calcaneus. 2. examine the scenario and indicate...

1. which of the following muscles originate on the calcaneus.

2. examine the scenario and indicate which specific: cranial nerves, muscles, parts of the brain and spinal cord are not functioning and what role they play.

Scenario:

Anna has been experiencing difficulty swallowing, she has seen a specialist and completed a swallow study. during her test the physician noticed that Anna's tongue has a severe curve to the left and was unable to close her mouth completely. it was observed that Annas breathing was shallow and rapid while her pulse remained steady and unaffected.

Solutions

Expert Solution

1. The muscles originate on the calcaneus are - Extensor digitorum brevis (on dorsolateral side of calcaneus), Abductor hallucis (at medial process of calcaneus tubercle), quadratus plantae (on lateral and medial of calcaneus)extensor hallucis brevis (on dorsal side of calcaneus) ,Abductor digiti minimi (on calcaneus tubercle), flexor digitorum brevis (on calcaneus tubercle ).

2. The cranial nerves, muscles, parts of the brain and spinal cord are not functioning in above scenario -

Cranial nerves involved - glossopharyngeal ,vagus ,hypoglossal nerve,facial nerve

Muscles - Glossopharyngeal nerve innervating to stylopharyngeus and superior constrictor of pharynx., Vagus nerves innervating to palatoglossus muscles of tongue and striated muscles of the pharynx and larynx, hypoglossal nerve innervating to extrinsic and intrinsic muscles of tongue.The facial nerve innervates to the facial muscles and helps in the opening and closing of the mouth.

Part of brain and spinal cord - Medulla oblonga of the brain stem (glossopharyngeal ,vagus ,hypoglossal nerve,) and Pons (facial nerve)

Roles they play - The hypoglossal nerve originates from the medulla oblongata and innervates the muscles of tongue ,functions in movement of tongue.The vagus nerve originates from the medulla oblongata and innervates the muscles tongue ,pharynx and larynx ,functions in regulation of respiratory activity. The glossopharyngeal nerve originates from the medulla oblongata and innervates the pharynx muscles, functions in swallowing. The facial nerve originates from Pons and innervates the facial muscles, functions in opening and closing of mouth.

gladiator answered 1 year ago

Next > < Previous

Related Solutions

For each motion, identify the upper body muscles involved. Also, indicate which muscles are the agonists...

For each motion, identify the upper body muscles involved. Also, indicate which muscles are the agonists and which are the antogonists. Indicate nerves for each as well. 1. Throwing a dart 2. Setting a volleyball

In this discussion, you will examine ways in which muscles can be weakened or strengthened. Objectives...

In this discussion, you will examine ways in which muscles can be weakened or strengthened. Objectives Describe the gross and microscopic anatomy of skeletal muscle. Describe the anatomical differences between skeletal, smooth, and cardiac muscles. Explain the current concept of muscle contraction based on three factors: neuroelectrical, chemical, and energy sources. Define muscle tone. Compare isotonic and isometric contractions. Step 1: Respond to the following: In addition to experiencing disorders and diseases that can affect muscles, people can strengthen or...

) The ileac blade provides attachment areas for the Gluteus medius and Gluteus minimus muscles. They “originate”...

) The ileac blade provides attachment areas for the Gluteus medius and Gluteus minimus muscles. They “originate” here; they “insert” into the neck and lateral trochanter of the femur, and when they contract, they pull in more or less a straight line between their origin and their insertion (the origins and insertions are marked on the cast of a full human skeleton; you can also see them on the figures in the study guide). Look again at the shape and orientation of...

Which of the following is a characteristic of a cytotoxic T cell? A) They originate in...

Which of the following is a characteristic of a cytotoxic T cell? A) They originate in bone marrow. B) They have antibodies on their surfaces. C) They are responsible for the memory response. D) They recognize antigens associated with MHC I. Which of the following cells can be classified as a professional antigen presenting cell? A) basophils B) red blood cells C) natural killer cells D) dendritic cells Which of the following destroys virus-infected cells? A) cytotoxic T cells B)...

#2 In the following table, indicate the effect of each scenario on the aggregate demand curve....

#2 In the following table, indicate the effect of each scenario on the aggregate demand curve. Scenario Change in Aggregate Demand Government spending increases.(Increases or Decrease) The amount of taxes collected decreases. (Increases or Decreases) #4 Why does a reduction in taxes have a smaller multiplier effect than an increase in government spending of an equal amount? A tax cut directly injects zero new spending into the economy because the government has purchased no new goods and services. An increase...

list two (2) muscles involved with inspiration and two (2) muscles involved in expiration which root...

list two (2) muscles involved with inspiration and two (2) muscles involved in expiration which root transmits sensory information, and which root transmits motor information, respectively? what is the muscle of the sural region which has two heads to it? what is the name of the smooth muscle which regulates the opening referenced in the previous question? what is the name of the innermost layer of the eye which contains the visual sensory endings? what are nerve tracts called in...

1) If you are searching for the muscles of the perineum, which statement about these muscles...

1) If you are searching for the muscles of the perineum, which statement about these muscles will help you CORRECTLY identify them? A. They include the deep transverse perineal and external urethral sphincter. B. They overlie (are superficial to) the erectile tissues. C. They are within the anal triangle. D. They are innervated by the S3-5 spinal nerves. E. They include the levator ani and coccygeous. 2) When the blood becomes acidic (acidosis) and bicarbonate ions have been depleted, new...

On the sequence below: 1. Indicate the direction of transcription 2. Indicate which is the coding...

On the sequence below: 1. Indicate the direction of transcription 2. Indicate which is the coding strand and which one is the template for the transcription 3. Write down the mRNA 4. Write down the protein clearly indicating the first codon on the mRNA(hint: find the Kozak sequence RCCAUGG to identify the first codon) 5. Introduce a nonsense mutation 3' AGTCGACTGGCATCAGACTACGCTGTGACTGATACGCGTTTTATTGGATCGCACCGCATACAGGGCCCCGGTACCGTCCAAAACT CCCGAGTAGTCAGATGTCAGCAGCGAAATATACGG 5' 5'TCAGCTGACCGTAGTCTGATGCGACACTGACTATGCGCAAAATAACCTAGCGTGGCGTATGTCCCGGGGCCATGGCAGGTTTTGAGGGCTCATCAGTCTACAGT CGTCGCTTTATATGCC 3'

indicate which of the following statistical tests is best suited for the given research scenario. You...

indicate which of the following statistical tests is best suited for the given research scenario. You do not need to actually carry out the test (and in some cases, you haven’t been given enough information to do so); just tell us which test is the most appropriate. 1) A researcher is interested in the relationship between job satisfaction and stress. Within a large corporation, the researcher asked a random sample of workers two questions. The first question asked workers to...

indicate which of the following statistical tests is best suited for the given research scenario. You...

indicate which of the following statistical tests is best suited for the given research scenario. You do not need to actually carry out the test (and in some cases, you haven’t been given enough information to do so); just tell us which test is the most appropriate. On your answer sheet, simply indicate the letter associated with the appropriate test for each question: 1) We are interested in testing whether there is a difference in the average income between elderly...

Subjects