Question

In: Chemistry

Explain the process of electro-osmotic flow in capillary zone electrophoresis and how electro-osmotic flow modifiers like...

Explain the process of electro-osmotic flow in capillary zone electrophoresis and how electro-osmotic flow modifiers like TTAB can reduse or reverse this flow

Solutions

Expert Solution

Inside the separation capillary is the solution that contains the analytes or the molecules to be separated and the buffer or electrolytic medium that is in charge of conducting the current. The interior is formed by groups silanol (Si-OH), which when being deprotonated (Si-O), raise considerably pH and favor the presence of specific analytes.

As has been said, the separation is carried out according to the mass / charge ratio of the different molecules. For this to be possible it is necessary to apply a potential difference (100 to 500 V / cm) between the two ends of the capillary that will cause the molecules to move towards one end or the other of the capillary (electrophoretic mobility: cationic molecules towards the negative pole and the anionics towards the positive pole) and that they are separated from each other.

In addition, there is another phenomenon inside the capillary called electroosmotic flow that occurs because the internal surface of the capillary is charged. The electroosmotic flow is the same within the entire capillary and affects all molecules in the same way by dragging them towards one of the ends. Thus, the separation will be affected by the electroosmotic flow and by the electrophoretic mobility of each of the molecules.

In the capillaries of molten silica the direction of the electroosmotic mobility is towards the negative electrode, which causes that cationic analytes can be separated quickly, although it can be quite negative for the separation of the anionic analytes, which could require a direction of electroosmotic mobility in the opposite direction. To achieve this reversion of the flow, ammonium salts containing long alkyl chains are added to the electrolyte, the CTAB and the TTAB are the most used to change the flow direction.


Related Solutions

Discuss capillary (zone) electrophoresis, micellar electrokinetic chromatography (MEKC) and capillary electrochromatography. Describe similarities and differences in...
Discuss capillary (zone) electrophoresis, micellar electrokinetic chromatography (MEKC) and capillary electrochromatography. Describe similarities and differences in working principle, injection, and separation. Discuss advantages and disadvantages of each of these techniques. Which compounds would you separate with each of these techniques?
What are the benefits and drawbacks in CZE (Capillary Zone Electrophoresis) with other more conventional separation...
What are the benefits and drawbacks in CZE (Capillary Zone Electrophoresis) with other more conventional separation technique, such as HPLC (High Performance Liquid Chromatography)?
Describe the key components in a capillary electrophoresis system, and explain how making adjustments to each...
Describe the key components in a capillary electrophoresis system, and explain how making adjustments to each component can have a feedback effect on the separation that is observed?
1. During the process of electrophoresis, the ________ functions like a molecular sieve, separating the samples...
1. During the process of electrophoresis, the ________ functions like a molecular sieve, separating the samples according to their size. A) agarose gel B) sample mixture C) positively charged electrode D) negatively charged electrode 2. The restriction enzyme SacI has a recognition sequence of GAGCT^C, where the caret (^) indicates the cut site. Examine the DNA molecule below. AGAGCTCAGTCGAGAGCTCAGATCGATAGGAGCTCAGATCTCGATCACCTC TCTCGAGTCAGCTCTCGAGTCTAGCTATCCTCGAGTCTAGAGCTAGTGGAG How many separate molecules of DNA would you end up with if you treated the above DNA molecule with SacI?...
how do adhesion and cohesion explain capillary action? how does water dissolve a substance like NaCl?...
how do adhesion and cohesion explain capillary action? how does water dissolve a substance like NaCl? Draw a picture illustrating this
describe the process of bulk fluid movement across capillaries.how would hypertension impact capillary bulk flow?
describe the process of bulk fluid movement across capillaries.how would hypertension impact capillary bulk flow?
explain how to prepare sample solutions and capillary applicators
explain how to prepare sample solutions and capillary applicators
Human Physiology Explain in detail the process that establishes and maintains the medullary osmotic gradient in...
Human Physiology Explain in detail the process that establishes and maintains the medullary osmotic gradient in the kidneys. Then describe the effect this osmotic gradient has on the water in the renal tubules.
how blood flow to a capillary in the gastrointestinal tract can be reduced.  In your answer include...
how blood flow to a capillary in the gastrointestinal tract can be reduced.  In your answer include the terms arteriolar and sphincter. Please provide more specific information. Like an essay
-Describe the process of gel electrophoresis. How would the distance that each DNA fragment travelled on...
-Describe the process of gel electrophoresis. How would the distance that each DNA fragment travelled on your gel change if you were to make the gel using a higher percentage of agarose (for example 3%)? Explain -Describe the steps involved in a polymerase chain reaction (PCR), including the changes in temperature that are performed by the thermocycler and the purpose of each temperature change.
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT