Predict the function of the zebrafish gene represented by the Expressed Sequence Tag (EST), EH489154. Your...

Predict the function of the zebrafish gene represented by the Expressed Sequence Tag (EST), EH489154. Your analysis should include information about any open reading frames (if any), protein domains (if any) and any other analyses you deem relevant.

[please be detailed]

Expert Solution

EST name = EH489154

This corresponds to FDR107-P00016-DEPE-F_H15 FDR107 Danio rerio cDNA clone FDR107-P00016-BR_H15 5-, mRNA sequence.

GenBank ID = EH489154.1

See image for ORFs.

>EST sequence

GATTCGATATCGCGGCCGCGGATCCGACGAGTTCACTTTTATTGTATCAGTTGAGTGAGGTGACTCTCAG

GCTGGAAACAATGTTTGCACGCGGTGTCATCGTCCTTCTCTGTGTGCTAGTGGCCATATCTGATGGAGTG

AAGGTGCCAAAATGCCGGTACCCTGTTGGAGCATGCCCAATGAACTATTCACCTGTGTGTGGAACCAATG

GTGTAACATACAGCAATGAATGCTTGCTATGTGCTGCAATGAAGACATCGAAAATAAGGATCTTAATCCA

GAAGCAAGGCGAATGTTAAATAAACACCTGCAAGAATGACATGATAATTCAGCTTGGCACACCTTCTTCA

AGTCTTCAAGCTTTATTGTACTCATTCATTATGGCCTGATTTTGTAATGGTTTGATCCAAAAATAAATGT

TGCATATT

See image for BLASTn results.

gladiator answered 1 year ago

8. Explain how the lacZ gene will be expressed when bacteria with loss-of-function mutations in the...

8. Explain how the lacZ gene will be expressed when bacteria with loss-of-function mutations in the lacI gene are in an environment free of both lactose and glucose.

Before proceeding, you wish to know whether this gene is actually expressed in humans (your target...

Before proceeding, you wish to know whether this gene is actually expressed in humans (your target market for therapeutic development). ? Describe, in detail, 2 efficient experimental approaches to answer this question. Discuss whether your proposed methods measure synthesis or accumulation of the product.

Plant Physiology suppose you suspect your gene of interest is expressed during M -phase, what type...

Plant Physiology suppose you suspect your gene of interest is expressed during M -phase, what type of experiment(s) might you design to prove your hypothesis?

Your preference is represented by the utility function: u(x1, x2) = x10.5x20.5 where x1 is potato...

Your preference is represented by the utility function: u(x1, x2) = x10.5x20.5 where x1 is potato chips (in bags) and x2 is chocolate bars. The price of a bag of potato chips is $5 and the price of a chocolate bar is $10. (a)You have no income, but you received a gift from your uncle. The gift is 9 bags of potato chips and 1 chocolate bar. What is your utility from consuming the gift? Assume that you cannot exchange...

Question