Create a PLA, that implements the following functions: F1 = ∑(0, 3, 5, 9) F2 =...

Create a PLA, that implements the following functions: F1 = ∑(0, 3, 5, 9) F2 = ∑(1, 4, 8, 12) F3 = ∑(1, 5, 15) F4 = ∑(2, 5, 9, 13, 14)

Solutions

Expert Solution

i am requesting you not to forget to upvote,Thank you

Given Functions are:

F1 = ∑(0, 3, 5, 9)

F2 = ∑(1, 4, 8, 12)

F3 = ∑(1, 5, 15)

F4 = ∑(2, 5, 9, 13, 14)

A PLA is a Programmable Logic Array which has programmble AND gates and Programmable OR gates.

Step1:

Reduction of the given functions using Kmap

for F1,we get

For F2,we get

For F3,we get

For F4,we get

Step2:

Implementation using a PLA

Total number of input buffers are 4,because we have four varibles,

Total number of AND gates are equal to minterms i.e. 13.

Total number of OR gates equal to the total number of functions i.e. 4.

Manojponduru answered 1 year ago

Next > < Previous

Related Solutions

Suppose that there are two independent economic factors, F1 and F2. The risk-free rate is 9%,...

Suppose that there are two independent economic factors, F1 and F2. The risk-free rate is 9%, and all stocks have independent firm-specific components with a standard deviation of 49%. Portfolios A and B are both well-diversified with the following properties: Portfolio Beta on F1 Beta on F2 Expected Return A 2.4 2.6 27 % B 3.0 –0.26 22 % What is the expected return-beta relationship in this economy? Calculate the risk-free rate, rf, and the factor risk premiums, RP1 and...

Compute each of the following: a. F1+F2+F3+F4+F5 b. F1+2+3+4 c. F3xF4 d. F3X4 Given that FN...

Compute each of the following: a. F1+F2+F3+F4+F5 b. F1+2+3+4 c. F3xF4 d. F3X4 Given that FN represents the Nth Fibonacci number, and that F31 =1,346, 269 and F33 = 3,524,578, find the following: a. F32 b. F34 25. Solve the quadratic equation using the quadratic formula: 3x^2-2x-11=0

for each of the five functions f1-(x,1/y) ,f2-(0,y) ,f3 (x+2y,y) ,f4-(x-2,y+1) ,f5 (x,y^3-y) prove or disprove...

for each of the five functions f1-(x,1/y) ,f2-(0,y) ,f3 (x+2y,y) ,f4-(x-2,y+1) ,f5 (x,y^3-y) prove or disprove that fn is distance-preserving

Consider the following functions. f1(x) = cos(2x), f2(x) = 1, f3(x) = cos2(x) g(x) = c1f1(x)...

Consider the following functions. f1(x) = cos(2x), f2(x) = 1, f3(x) = cos2(x) g(x) = c1f1(x) + c2f2(x) + c3f3(x) Solve for c1, c2, and c3 so that g(x) = 0 on the interval (−∞, ∞). If a nontrivial solution exists, state it. (If only the trivial solution exists, enter the trivial solution {0, 0, 0}.) {c1, c2, c3} =? Determine whether f1, f2, f3 are linearly independent on the interval (−∞, ∞). linearly dependent or linearly independent?

Consider the following vectors: →a = 5 −1 3 3 →b = 5 0 1 0...

Consider the following vectors: →a = 5 −1 3 3 →b = 5 0 1 0 →c = −10 3 −3 −7 For each of the following vectors, determine whether it is in span{→a, →b, →c}. If so, express it as a linear combination using a, b, and c as the names of the vectors above. →v1 = 5 −3 2 7 < Select an answer > →v2 = 2 7 6 −7 < Select an answer > →v3 =...

What scenerio will give a 9:3:3:1 F2 phenotypic ration in a mendelian cross

Consider the following set of vectors in R6 S={[-9 7 -8 3 0 -5], [1 -7...

Consider the following set of vectors in R6 S={[-9 7 -8 3 0 -5], [1 -7 3 2 -8 -8], [-6 -14 1 9 -23 -29], [11 -21 14 1 -16 -11], [8 16 -8 8 10 1], [17 -7 13 -8 8 18] (a) (2 points) Demonstrate that S is not a basis for R6. (b) (4 points) Let H = Span S. Find a basis for H and determine its dimension. (c) (2 points) Determine whether v= [1,1,1,−1,−1,−1]...

Using Matlab 1. Solve the following equations set f1 (x1,x2) = sin (sin (x1)) +x2 f2...

Using Matlab 1. Solve the following equations set f1 (x1,x2) = sin (sin (x1)) +x2 f2 (x1,x2) = x1+ e^(x2) a) Can this equation set be solved by the fixed - point method with the following expressions? And why? Show your analysis with a 2D graph. g1 (x1,x2) = -e^(x2) g2 (x1,x2) = -sin⁡(x1) b) Use Newton Raphson Method with initial values x1 = -2, x2 = 1.5. (8 significant figures. Please submit the code and results.)

3. Fluorine reacts with vanadium to produce vanadium(V) fluoride according to the following equation: 5 F2...

3. Fluorine reacts with vanadium to produce vanadium(V) fluoride according to the following equation: 5 F2 (g) + 2 V (s) → 2 VF5 (l) (a) How many moles of vanadium are needed to react completely with 0.1917 g of fluorine? (b) What is the maximum theoretical mass of vanadium(V) fluoride that can be produced? (c) If 0.225 g of vanadium(V) fluoride is obtained, what is the percent yield of VF5 (l)? Molar masses (g/mol): F2 38.00 VF5 145.93

9. If the following mutation occurs in COVID19 RNA 5’ GGGUACAUGGUAGCCCCCGUCGAGAAAACACCC…. 3’ to 5’ GGGUACAUGGUAGCCCCCGUCGCCCCGUAGAAAACACCC…. 3’,...

9. If the following mutation occurs in COVID19 RNA 5’ GGGUACAUGGUAGCCCCCGUCGAGAAAACACCC…. 3’ to 5’ GGGUACAUGGUAGCCCCCGUCGCCCCGUAGAAAACACCC…. 3’, what most likely would be the outcome of such a change in its sequence: A frameshift mutation effect A silent mutation effect No effect resulted from the mutation A nonsense mutation effect A missense mutation effect 10.To conduct molecular analyses of COVID19 RNA sequence, which of the following biotechnology should be used to amplify samples of RNA: RNA Recombinant Plasmid Duplication RNA Fingerprinting Replication...

Subjects