1. Princess eats 60g of oats for breakfast before her biology exam. Each gram of oats...

1. Princess eats 60g of oats for breakfast before her biology exam. Each gram of oats contains three (3) molecules of glucose.

a. Assuming Princes uses 180 molecules of adenosine triphosphate in consuming breakfast and cleaning up after breakfast, calculate the net ATP Princes has from breakfast for her morning activities.

b. Describe how Princess generates the net energy from ATP by substrate level phosphorylation for her biology exam.

c. State the total number of ATP generated from oxidative phosphorylation. Describe how this number is generated.

2. You have been given a DNA fragment obtained from the genome of Bacillus thuringiensis below:

3’CACTAACTGTCGCCAGGTCTGATAGACATATAACTGTTGGCGTACATAAGAAGGATCAAAAAA5’

Additional tools are provided below.

a. Provide the complementary strand for the parent strand (above) that would be synthesized during replication of the linear DNA fragment

b. List the enzymes involved in this DNA replication

c. Use the parent strand as a template to synthesize mRNA strand. Describe how the mRNA strand is generated and regulated. Indicate the direction of synthesis.

d. Synthesize a polypeptide from the mRNA.

TOOLS:

a. Primer: GUGAUU

b. Codon table

Expert Solution

gladiator answered 1 year ago

Hanna, who is a 5-year-old girl, eats nothing but pasta, yogurt, and lemonade. Each month her...

Hanna, who is a 5-year-old girl, eats nothing but pasta, yogurt, and lemonade. Each month her parents buy 25 pounds of pasta, 65 packages of yogurt, and 15 bottles of lemonade. These three items make up a basket of goods and services similar to the much larger basket used by the Bureau of Labor Statistics (BLS) when computing the official Consumer Price Index (CPI). The table below lists the average price for each item in this basket for the past...

The following indicates the number of hours that Johnny spent studying the week before each exam...

The following indicates the number of hours that Johnny spent studying the week before each exam in his classes along with the corresponding exam scores: Hours Studying: 4 5 8 12 15 19 Score on Exam: 54 49 60 70 81 94 Find the residual corresponding to the explanatory value of 8. a) 69.8263 b) −0.82 c) −69.8263 d) −126.34 e) 0.82

For each of the following determine if its: gram (+),gram(-), both or neither 1. contains teichoic...

For each of the following determine if its: gram (+),gram(-), both or neither 1. contains teichoic acids 2. contains mitochondria for energy production 3. contain 70s ribosomes 4. loses color when decolorizer applied during gram stain 5. contains peptidoglycan 6. contains a lipopolyaccharide layer 7. contains interbridges (crosslinks)that hold tetrapeptides together

1. Assume you decide to go to the movies the night before an exam instead of...

1. Assume you decide to go to the movies the night before an exam instead of staying home to study. You scored an 80% on the exam. Generally, you score 87% on exams. a. What was the opportunity cost of going to the movies? b. Was the cost greater than the benefit? 2. How is marginal cost measured? Slope of a point on the curve = O.C. of the good on the X axis at that point 3. How is...

1. Can iodine be added before the primary stain in a Gram stain? Explain. If iodine...

1. Can iodine be added before the primary stain in a Gram stain? Explain. If iodine was added before the primary stain, what would be the final color of gram positive and gram negative cells in the stain and why? 2. Since you can’t identify bacteria from a Gram stain, why might a physician perform a Gram stain on a sample before prescribing an antibiotic? 3. The cell envelope of Mycobacterium sp. is unlike the envelope of other bacteria. While...

1) Before an exam, a student has only studied 20 of the 28 topics corresponding to...

1) Before an exam, a student has only studied 20 of the 28 topics corresponding to the subject of the exam. This is done by randomly extracting two subjects and leaving the student to choose one of the two to be examined. Find the probability that the student can choose one of the topics studied in the exam. 2) The compressive strength of a series of cement samples can be modeled with a normal distribution with an average of 6000...

Problem 1. In the distant future, a physics student is rushing to her final exam traveling...

Problem 1. In the distant future, a physics student is rushing to her final exam traveling in a spaceship at relativistic speed. She passes a policeman at rest a distance 9 km from a traffic signal (measured in his rest frame). a) The policeman monitors the student’s tail lights (red light with λ=650 nm in her rest frame) with a spectroscope, viewing directly along her motion away from him. He observes a wavelength λ=1300 nm (infrared). What is her speed...

In nearly every chapter, the author outlines the purported reasonableness of each WMD before raising her...

In nearly every chapter, the author outlines the purported reasonableness of each WMD before raising her own objections to it. Were you surprised by any of O’Neill’s objections? Were there any you feel were unfair? Any you feel did not go far enough?

1)Please list the purpose of each of the following reagents in the Gram Stain: Crystal Violet,...

1)Please list the purpose of each of the following reagents in the Gram Stain: Crystal Violet, Iodine, 95% alcohol, Safranin. 2)What color would a Gram negative cell be if we skipped the alcohol step? What color would a Gram positive cell be if we skipped the same step? Why?

1. What is the gram stain classification for each bacteria used: Hemophilus Influenzae: Staphylococcus...

1. What is the gram stain classification for each bacteria used: Hemophilus Influenzae: Staphylococcus aureus: Streptococcus pneumonia: 2. What are the gram types of the bacteria each of the antibiotics (penicillin, amoxicillin, erythromycin) used in the lab are effective against? If the antibiotic works better against one Gram type explain why. (4 points) penicillin: amoxicillin: erythromycin:

Question