What viral matrix proteins would you expect to be present in a (hypothetical) double-stranded RNA bacteriophage...

What viral matrix proteins would you expect to be present in a (hypothetical) double-stranded RNA bacteriophage that replicates in Gram-positive bacteria? Explain why each would be necessary.

Expert Solution

Answer:

Double-stranded DNA bacteriophages and herpesviruses assemble their heads in a similar fashion; a pre-formed precursor called a prohead or procapsid undergoes a conformational transition to give rise to a mature head or capsid.
A virus-encoded prohead or procapsid protease is often required in this maturation process.
Through computational analysis, we infer homology between bacteriophage prohead proteases (MEROPS families U9 and U35) and herpesvirus protease (MEROPS family S21), and unify them into a procapsid protease superfamily.
We also extend this superfamily to include an uncharacterized cluster of orthologs (COG3566) and many other phage or bacteria-encoded hypothetical proteins.
On the basis of this homology and the herpesvirus protease structure and catalytic mechanism, we predict that bacteriophage prohead proteases adopt the herpesvirus protease fold and exploit a conserved Ser and His residue pair in catalysis.
Our study provides further support for the proposed evolutionary link between dsDNA bacteriophages and herpesviruses.

Please Rate My Answer............Thank............u...

gladiator answered 1 year ago

RNA may fold back onto itself to form regions of double-stranded RNA. (a) Describe at least...

RNA may fold back onto itself to form regions of double-stranded RNA. (a) Describe at least two structures found in double-stranded regions of RNA. (b) What features of RNA contribute to the stability of these double-stranded RNA regions? essay answer are limited to about 600 words

A double-stranded fragment of viral DNA, one of whose strands is shown below, encodes two peptides,...

A double-stranded fragment of viral DNA, one of whose strands is shown below, encodes two peptides, called vir-1 and vir-2. Adding this double stranded DNA fragment to an in vitro transcription and translation system yields peptides of 10 residues (vir-1) and 5 residues (vir-2). 5’ AGATCGGATCGTCAACTATATGTGATTAACAGAGCATGCGGCATAAACT 3’ Identify the DNA sequence that encodes each peptide Determine the amino acid sequence of each peptide In a mutant viral strain, the T at position 23 has been replaced with a...

1. If you started a PCR protocol with 10 double-stranded molecules of DNA, how many double-stranded...

1. If you started a PCR protocol with 10 double-stranded molecules of DNA, how many double-stranded molecules of the product would you have after 5 cycles of PCR? 2. What is the purpose of using DNA polymerase from Thermus aquaticus for the polymerase chain reaction rather than a DNA polymerase from a better characterized bacterium such as E. coli?

What are the functions of viral structural proteins?

During which stage of the viral life cycle would viral capsid proteins be manufactured? A. Assembly...

During which stage of the viral life cycle would viral capsid proteins be manufactured? A. Assembly B. Biosynthesis C. Release D. Entry

QUESTION 38 Viral capsules are studded with a. RNA polymerases b. Reverse transcriptase c. Proteins which...

QUESTION 38 Viral capsules are studded with a. RNA polymerases b. Reverse transcriptase c. Proteins which bind to host cell surface proteins d. Double-stranded DNA 2 points QUESTION 39 The scientists who worked out the structure of DNA and received the Nobel Prize for this discovery are: a. Darwin and Newton b. Hershey and Chase c. Morgan, Griffith and Avery d. Watson, Crick and Wilkins 2 points QUESTION 40 The two strands of the DNA double helix are...

What polypeptide sequence would you expect to be translated from the following unprocessed eukaryotic RNA sequence...

What polypeptide sequence would you expect to be translated from the following unprocessed eukaryotic RNA sequence 3ʼ AAG AUC UAA UAU UAC ACC GUA 5ʼ (the third and forth codons from the left are introns). Select one: a. N-terminus Met-Pro-His-Tyr- Asn-Leu-Glu C-terminus b. None of these answers is correct c. N-terminus Met-Pro-Asn-Leu-Glu C-terminus d. C-terminus Lys–Ile C-terminus e. N-terminus Lys-Ile C-terminus

Different types of cells have different types of integral membrane proteins. What would you expect to...

Different types of cells have different types of integral membrane proteins. What would you expect to reside in the plasma membrane of an epithelial cell that might be absent from that of an erythrocyte? How do such differences relate to the activities of these cells? explain d in etail and give reference. (15points)

1.Would you expect the viral load in the blood of HIV-infected individuals in the early years...

1.Would you expect the viral load in the blood of HIV-infected individuals in the early years of the asymptomatic phase of HIV-1 infection to vary significantly (assuming no drug treatment)? What about CD4+ T-cell counts? Why? Explain. 2. Beginning with sensitisation, describe the immune events that you expect to take place following the transplantation of a kidney between nonidentical siblings who share half their MHC molecules. You can assume that they are matched for ABO blood group antigens and have...

State for each of the eight types of proteins listed below whether you would expect that...

State for each of the eight types of proteins listed below whether you would expect that protein to have one of the four options, and give a short explanation why: - a nuclear localization signal (NLS), - a mitochondrial signal sequence, - an ER signal sequence, or - no signal sequence. Insulin = ? Adenylyl cyclase = ? Caspase-9 = ? Rb protein = ? Cytochrome c reductase subunit = ? Lysosomal proton (H+) pump = ? Lamin-A protein =...

Question