Question

10. a. A local farmer is selling baby chickens (chicks) to Walla Wallans, but after 2 days they notice that some of the birds don’t look very healthy. The farmer used to be a microbiologist at the community college. If they still have access to lab space, how would they identify whatever is causing the infection? (6 pts)

b. The organism Salmonella typhimurium can often infect birds and can pass that infection on to humans. The farmer decided that they wanted to go a step further from their previous efforts (in part b) and sequences the 16S gene of the organism that was isolated. Part of that sequence is shown below. Is the organism infecting the birds likely S. typhimurium? Explain why or why not. (4 pts)

S. typhimurium: GCATCTGAGACCCGATCCAG

Escherichia coli: CGATCTGAGACACGGTGGAG

Isolated strain: GCATCTGAGACCCGATCCAG

c. How would the farmer determine the LD50 for this organism? (3 pts)

Answer 1

a) Laboratory diagnosis of the given case :-

• Advanced techniques

Specimens stool and body tissue fluid collected from birds and tested in the laboratory. Through this test can be identified general types of bacteria causing illness in the birds and animals. This type of test may not need cultures or to grow bacteria in the laboratory. Nowadays we are using molecular techniques.

• Lab diagnosis for bacterial diseases.

1) Specimen collection

2) Culture and morphological staining of bacteria :- Using culture medias for Isolation and identification of isolated colonies, Gram staining is done for identifying the morphology of isolated bacterial colonies.

3) Motility test :- to differentiate motile or non- motile.

4) Hemolytic activity

5) Reactions of organisms in TSI agar

6) Sugar fermentation test

7) Indole test, Methyl red test,Voges Proskauer test

8) Catalase test, Coagulate test.

b) From the given data we can see that the sequence of isolated strain and the sequence of Salmonella typhimurium is same. So we can assume that the disease is may be due to the infection from Salmonella typhimurium. But one isolate could not be classified by serotyping That's why we have to go for further analysis through phage typing and macro restriction pulsed field gel electrophoresis. Then we can confirm that the infection is due to Salmonella typhimurium or not.

c) To determine the LD50 (Lethal dose 50), the farmer have to know the concentration of bacteria and also be sure that it is lethal for test subject. Then farmer would raise the concentration of bacteria administered to the test subjects, by standard and small amounts, Observe in which amount the test subject showing 50% of lethality, then it will be LD50 of that organism and many repetitions of this experiment must be carried out to determine the dose or amount for every combination and target population.