Question

In: Nursing

In one of the southern regions of the planet, several people were diagnosed with cholera. This...

In one of the southern regions of the planet, several people were diagnosed with cholera. This is a particularly dangerous infectious disease that can spread rapidly if urgent measures are not taken. A patient with acute diarrhea, vomiting, muscle weakness, and spasms in the calf muscles was admitted to the admission department of the hospital. The skin of the hands is wrinkled, blood pressure is low. Examination of the patient confirmed the diagnosis of cholera. The causative agent of cholera, cholera vibrio, produces a toxin, one of the promoters of which is an enzyme - ADP-ribosyltransferase. Explain the mechanism of action of model toxin.
For an answer
1. Write the reactions catalyzed by this cholera toxin enzyme;
2. Explain the consequences of this reaction for the adenylate cyclase system in the cells of the intestinal mucosa;
3. Describe how cholera symptoms develop as a result of the toxin.

Solutions

Expert Solution

ADP ribosylation of membrane proteins are catalyzed by cholera toxin enzyme - ADP ribosyl transferase.

In the presence of ATP and a cytosolic factor, cholera toxin fragment A1 catalyzes the transfer of ADP ribose from NAD to a number of soluble and membrane bound proteins of the erythrocyte. The most readily modified membrane protein ( Mr 42000) is the adenylate cyclase associated GTP binding protein. It's modification by toxin is stimulated by guanine nucleotides. Adenylate cyclase activity increases in parallel with the addition of ADP ribose to this protein and decreases in parallel with the subsequent reversal of ADP ribosylation by toxin and nicotinamide.

The protein is only accessible to toxin A subunits if the erythrocytes are lysed. When adenylate cyclase activity reaches a maximum, the number of ADP ribose residues bound to this protein ( about 1500 per cell) is similar to the reported number of beta adrenergic receptors.

3. Cholera which is caused by Vibrio cholerae produces a toxin known as cholera toxin. This toxin causes the intestinal cells to release enormous amount of water leading to diarrhoea and loss of fluids and electrolytes ( electrolytes). Living in or traveling to areas where cholera is present raises the risk of getting it.


Related Solutions

Briefly describe the presentation of two people. One is diagnosed with hypochondriasis and one is diagnosed...
Briefly describe the presentation of two people. One is diagnosed with hypochondriasis and one is diagnosed with somatization disorder.
Suppose 26 people are on Planet Z, where they were born. What's the probability at least...
Suppose 26 people are on Planet Z, where they were born. What's the probability at least two of them have the same birthday? (On Planet Z, a year is about 400 days; you may assume a person is equally likely to have been born on any day in the Planet Z year.) b. Now suppose n people are on Planet Z, where they were born. Find the smallest n such that the probability that at least two of the people...
For several decades, it was a common practice in Southern California for houses to be built...
For several decades, it was a common practice in Southern California for houses to be built with pools in the backyard (as any airplane flight which ends at a Southern California airport will reveal). Now, however, that practice may be changing, possibly because of the recent demand for landscaped homes, which experts believe help reduce pollution. A recent study examined a random sample of 161 houses built in Southern California between 1950 and 1985 and an independent, random sample of...
You are planning to use PCR to amplify several regions of a piece of DNA. The...
You are planning to use PCR to amplify several regions of a piece of DNA. The sequence of your template DNA is provided below along with the sequences of all available primers. Determine where each of the primers bind and answer the following: 5' AGGGCCAAATGAGATGAGTCAAAAGCTGCCGATAACCGGATAG 3' 3' TCCCGGTTTACTCTACTCAGTTTTCGACGGCTATTGGCCTATC 5' Primer 1: 5-TTGGCC 3 P2: 5-GTCAAA-3 p3: 5-AACCGG-3 p4: 5-CCGGTT-3 P1 can bind to the bottom strand? P4 can bind to the molecule at only one location Which primer pair would...
For the Auricorus Blue-tailed Fly, that lives on the planet Trumpor, there are several recessive genes...
For the Auricorus Blue-tailed Fly, that lives on the planet Trumpor, there are several recessive genes that are all on the same autosome. In the following problems, a true breeding female fly that shows three distinct disease (gene) phenotypes is crossed to a wild-type male fly. An F1 female fly is then test-crossed to a true-breeding male fly showing all three disease phenotypes. Given the data below, what are the recombination fractions among all three loci? Gene A Phenotype: Muppeteritus...
Several modules of the GoHRM system were introduced in the class. Please choose one of the...
Several modules of the GoHRM system were introduced in the class. Please choose one of the following (or any others if you wish) to describe what you have learned. Then, please evaluate their functions in terms of areas such as the advantages and disadvantages, change of role of HR due to this function, comprehensiveness of this function, reporting, etc. Altogether, the answers should be not more than 100 words. 1 – Recruitment 2 – Leave management 3 – Payroll and...
Suppose a planet was discovered with life and you were a member of a team of...
Suppose a planet was discovered with life and you were a member of a team of scientists who were selected to study these new life forms. During your analyses of fossils from this new planet you discovered that speciation rates appear to be 10 times faster than on Earth. Formulate a series of hypotheses (at least 5) for why speciation might be faster on the newly discovered planet. Each hypothesis should include an explanation of how the mechanism would foster...
7. There are several succulent plants that exist in various regions of the world. What characteristics...
7. There are several succulent plants that exist in various regions of the world. What characteristics do they have in common? How are these advantageous in dry climates? Is this an example of convergent evolution? Why/why not?
Prior to arrival to the Americas of people from the western regions of Eurasia , small...
Prior to arrival to the Americas of people from the western regions of Eurasia , small pox was not an especially virulent or lethal disease in Europe. In the Americas, syphilis was similarly of a mild nature. Yet to Europeans syphilis was lethal as was small pox to the first Americans. Study geography of Eurasia and the Americas and develop an scientific hypothesis why this occurred.
#6. In 2008, there were 507 children in Arizona out of 32,601 who were diagnosed with...
#6. In 2008, there were 507 children in Arizona out of 32,601 who were diagnosed with Autism Spectrum Disorder (ASD) ("Autism and developmental," 2008). Find the proportion of children with ASD in Arizona with a confidence level of 99%. Blank #1: Report the bounds of the 99% confidence interval as lower bound,upper bound with commas in between and no additional spaces. Report bounds to three decimal places. So, in context, 99% confident that the true proportion of children with ASD...
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT