How does streaming traffic differ from browsing traffic (in terms of network utilization)?

1. Write a program which simulates rolling dice. It should: Display the random number rolled Ask the user if they want to roll again. If they don't want to roll again, the program should end. If they do want to roll again, the new number should display. At a minimum, the die should have 6 sides, but if you want to use a d12 or d20, that is fine too.

USE PYTHON

Complete a) flowchart solution and b) working Python solution. It will need to compare gene sequences, looking for differences (mutations), keeping track of how many are different and will include clear two-part output: indicating if the ‘baby’ has the mutation for diabetes or not, and the identity between the siblings’ sequences.

BABY:

ATGGCCCTGTGGATGCGCCTCCTGCCCCTGCTGGCGCTGCTGGCCCTCTGGGGACCTGACCCAGCCGCAGCCTTTGTGAACCAACACCTGTGCGGCTCACACCTGGTGGAAGCTCTCTACCTAGTGTGCGGGGAACGAGGCTTCTTCTACACACCCAAGACCTGCCGGGAGGCAGAGGACCTGCAGGTGGGGCAGGTGGAGCTGGGCGGGGGCCCTGGTGCAGGCAGCCTGCAGCCCTTGGCCCTGGAGGGGTCCCTGCAGAAGCGTGGCATTGTGGAACAATGCTGTACCAGCATCTGCTCCCTCTACCAGCTGGAGAACTACTGCAACTAG

BROTHER:

ATGGCCCTGTGGATGCGCCTCCTGCCCCTGCTGGCGCTGCTGGCCCTCTGGGGACCTGACCCAGCCGCAGCCTTTGTGAACCAACACCTGTGCGGCTCACACCTGGTGGAAGCTCTCTACCTAGTGTGCGGGGAACGAGGCTTCTTCTACACACCCAAGACCCGCCGGGAGGCAGAGGACCTGCAGGTGGGGCAGGTGGAGCTGGGCGGGGGCCCTGGTGCAGGCAGCCTGCAGCCCTTGGCCCTGGAGGGGTCCCTGCAGAAGCGTGGCATTGTGGAACAATGCTGTACCAGCATCTGCTCCCTCTACCAGCTGGAGAACTACTGCAACTAG

Does the ‘baby’ carry the mutation associated with diabetes?
Which (what number) nucleotide has mutated?
What is the ‘identity” of the siblings’ sequences? In other words, find the percentage, to one decimal place, describing how similar those two are.

--------------------------------------------------

So far I have this:

def find_mutation_location(nuc1, nuc2):
n = len(nuc1)
for i in range(0,n,3):
if nuc1[i:i+3] != nuc2[i:i+3]:
return (i+1)//3
  
n1 = "ATGGCCCTGTGGATGCGCCTCCTGCCCCTGCTGGCGCTGCTGGCCCTCTGGGGACCTGACCCAGCCGCAGCCTTTGTGAACCAACACCTGTGCGGCTCACACCTGGTGGAAGCTCTCTACCTAGTGTGCGGGGAACGAGGCTTCTTCTACACACCCAAGACCTGCCGGGAGGCAGAGGACCTGCAGGTGGGGCAGGTGGAGCTGGGCGGGGGCCCTGGTGCAGGCAGCCTGCAGCCCTTGGCCCTGGAGGGGTCCCTGCAGAAGCGTGGCATTGTGGAACAATGCTGTACCAGCATCTGCTCCCTCTACCAGCTGGAGAACTACTGCAACTAG"
n2 = "ATGGCCCTGTGGATGCGCCTCCTGCCCCTGCTGGCGCTGCTGGCCCTCTGGGGACCTGACCCAGCCGCAGCCTTTGTGAACCAACACCTGTGCGGCTCACACCTGGTGGAAGCTCTCTACCTAGTGTGCGGGGAACGAGGCTTCTTCTACACACCCAAGACCCGCCGGGAGGCAGAGGACCTGCAGGTGGGGCAGGTGGAGCTGGGCGGGGGCCCTGGTGCAGGCAGCCTGCAGCCCTTGGCCCTGGAGGGGTCCCTGCAGAAGCGTGGCATTGTGGAACAATGCTGTACCAGCATCTGCTCCCTCTACCAGCTGGAGAACTACTGCAACTAG"
print(find_mutation_location(n1,n2))

def calculate_similarity(nuc1, nuc2):
n = len(nuc1) // 3
different = 0
for i in range(0,n,3):
if nuc1[i:i+3] != nuc2[i:i+3]:
different += 1
print(calculate_similarity(n1,n2))

I seem to have been able to locate the mutation at nucleotide number 54, but am having issues with calculating the similarity to a percentage/1 decimal point. Please advise, and also provide working flow-chart solution if possible. Thanks!

There is no question the router plays a vital role in networking. If this device were to be controlled by an attacker, then the entire CIA goal can be violated. As such, you can argue about the need to protect the router administratively, physically, and technically. Our focus again is on the technical part. Having said this, discuss the methods that can be used on a standard IOS router that will prevent unauthorized access to the router. Also, discuss how privilege levels and role-based CLI can improve the security on the router.

2. Begin by defining the data type Point that has two coordinate members x and y. Specifically, Point will be implemented as a structure; define operators as needed to satisfy problem requirements.

b, prompt the user to input several (x,y) pairs. As the data is entered, store it in a vector of Points called orginal_points. Input is terminated with the EOF character (differs by OS type). To be clear, I am asking you to define an input stream operator to read the point format: (x,y). As an example, the input of (5,6) is the correct input format for a point. While the I/O format includes the ‘(‘, ‘,’, and ‘)’ characters, the internal storage contains only the x and y values. Please Note -- I am expecting a robust, user-friendly way to ensure Points are entered correctly and in a valid format. A simple termination of the program is not acceptable here -- If I’ve entered a number of valid points, don’t discard them -- recover from the error so that input can continue (if possible) and if input cannot continue, ensure that the program proceeds to save the points I have entered. Also important -- this input stream operator needs to work with standard input (cin) and formatted (text) file input streams.

3. Print the data in original_points to the screen so we can see what it looks like. Create an output stream operator for this that works with both cout and output file streams.

4. Open an ofstream and write each Point to a file named mydata.txt, using the operator you created in #3 above. Be sure to include the Points in the correct format, one Point per line. Explicitly close the file. Next, inspect the file. It should have the same contents as what you printed on the screen. Does it?

5. Open the file and, using the same input logic that you created in b, read in the Point data and print the results to the screen. (This is to demonstrate that your input operator is flexible to be used with multiple stream types. Since the data in the file should conform perfectly to the required format, your input checking should run smoothly here…) it's c++ language and Input error handling -- Points data structure

   #include <iostream>
   #include <fstream>
   #include <vector>
   using namespace std;
   
   struct Point{
       int x, y;
       bool operator==(const Point& p2) {
           return this->x == p2.x and this->y == p2.y;
       }
       bool operator!=(const Point& p2) {
           return this->x != p2.x or this->y != p2.y;
       }
       friend ostream &operator<<( ostream &out, const Point &P ) { 
            out << "(" << P.x << ", " << P.y << ")";
            return out;
       }
   
       friend istream &operator>>( istream  &in, Point &P ) { 
           char d1, d2, d3;
           // input format: (1, 2)
           in >> d1 >> P.x >> d2 >> P.y >> d3;
           return in;
       }
   };
   
   int main()
   {
       vector<Point> original_points;
       cout << "Enter points :\n";
       Point P;
       while( cin >> P )
       {
           original_points.push_back(P);
       }
   
       ofstream out("mydata.txt");
       cout << "You entered the points:\n";
       for(Point p: original_points)
       {
           cout << p << '\n';
           out << p << '\n';
       }
       out.close();
       //pause
       cin.get();
       char ch;
       cout << "Press enter to continue: ";
       getchar();
   
       ifstream in("mydata.txt");
       vector<Point> processed_points;
       while( in >> P )
       {
           processed_points.push_back(P);
       }
       int n = original_points.size();
       for(int i=0; i<n; i++)
       {
           if(original_points[i] == processed_points[i])
           {
               cout << "Points at index " << i << " are same\n" 
                    << original_points[i] << " "
                    << processed_points[i] << '\n';
           }
           if(original_points[i] != processed_points[i])
           {
               cout << "Points at index " << i << " are not same\n"
                    << original_points[i] << " "
                    << processed_points[i] << '\n';
           }
       }
   } depend on this code write error handling code

IN C LANGUAGE ONLY PLEASE!

First Program:

1. create branchloop.c file
2. Content of the program
   1. Enter your name while running your program as you did with hello2.c (using argc and argv) name has to be 2 words max (e.g. Jose Lopez, Maria Rodrigues) . Make sure to check properly.
   2. Print your name 10 times using a loop. 10 is a fixed number.
   3. Count how many characters are in your first name and last name.
   4. If the number of characters of your first name is greater than last name print my first name is bigger than my last name.
   5. If the number of characters of your first name is less than last name then print my last name is bigger than my first name.
   6. If the number of characters is equal then print my first and last name have the same number of characters.
3. Compile the program using: gcc -o branchloop branchloop.c
4. Run the program using: ./branchloop firstname lastname

Second Program:

1. Copy branchloop.c to branchloop2.c
2. Restructure program to add the following functionality
3. Enter a number at command line representing an index to your name along with your name. e.g. ./branchloop2 carlos alonso 5
4. The index number must be within the size of your full name - if is not an error should be provided (number is larger than your full name).
5. If the number fits the length of your name, use the number to find the letter correspond to it by indexing.
6. Finally print your name in all lower case, print index number, and print character indexed in upper case.

Third program:

1. Copy branchloop2.c to branchloop3.c
2. Use the number entered in command line to:
   1. Print your name that many times
   2. Use a Do-While loop
3. Count the number of letters in your name.
4. Print the number of characters in your name followed by your name backwards.

Create a python program that will:

• prompt a user for a command

• Command

  • get_data

• Level 1: Take one of the commands

  • my_max

  • my_min

  • my_range

  • my_sum

  • mean

  • median

  • mode
  • fib
  • factorize
  • prime

Requirements:

• Your commands should be case-insensitive

• You should use python lists to store data

• You should NOT use built-in python math functions, or math libraries to compute these values

Tips:

• Write one function that will convert a string with comma-separated numbers into a python list with the numbers. You can use this in multiple other functions.

• Don't name any of your functions "min", "max", or "range" or "sum". These are built-in functions.

Details

Load command details

• Get_data: prompts users for a list of numbers, separated by commas

  • (please also print the list, for testing)

Level 1 details (these functions work with the loaded data list)

• my_max

• my_min

• my_range: Computes the range (difference of greatest value and least value)

• my_sum

• mean: Computes and prints the arithmetic mean (average)

Level 2

• median: show the median (middle value, or average of two middle values)

• mode: show the mode, or modes

Level 3 details (these functions should use the first number in the data list)

• prime: determine if a number is prime

• factorize: get the prime factors of a number

• fib: get the nth number in the fibonacci sequence

Here is my code so far:

#hehe my sum and stuff
f = open("input.txt",'r')
def input(prompt=''):
print(prompt, end='')
return f.readline().strip()   

#get data
def get_data():
pass

line = input().strip().split(',')
  
nums=[]
for n in line:
nums.append(float(n))

  
return nums
  
#get sum
def my_sum(data):
  
s=0
for n in data:
s += n
return s
  
pass

#get max
def my_max(data):
  
m=0
for n in data:
m >= n
return m

pass

#get min
def my_min(data):
  
i=0
for n in data:
i < n
return i

pass

#get range
def my_range(data):
r=0
for n in data:
m - i
return r

pass

#get mean
def mean(data):
e=0
for n in data:
????????

#get median
def median(data):
d=0
for n in data:
??????
  
#get mode
def mode(data):
o=0
for n in data:
???
  
#get prime
def prime(data):
p=0
for n in data:
???

#get factorization
def factorization(data):
f=0
for n in data:
????
  
#get fib
def fib(data):
b=0
for n in data:
??
#run it
def run_cli():
  
while(1):
cmd = input()
  
if cmd=='exit':
break
  
elif cmd=='get_data':
data = get_data()
print(data)
  
  
elif cmd=='my_sum':
s = my_sum(data)
print(s)
  
elif cmd=='my_max':
m = my_max(data)
print(m)
  
elif cmd=='my_min':
i = my_min(data)
print(i)
  
elif cmd=='my_range':
r = my_range(data)
print(r)
  
elif cmd=='mean':
e = mean(data)
print(e)
  
elif cmd=='median':
d = median(data)
print(d)
  
elif cmd=='mode':
o = mode(data)
print(o)
  
elif cmd=='prime':
p = prime(data)
print(p)
  
elif cmd=='factorization':
f = factorization(data)
print(f)
  
elif cmd=='fib':
b = fib(data)
print(b)
  
pass

#ha ahsbas
def main():
run_cli()
  
main()

write the code in python

Design a class named PersonData with the following member variables:

• lastName
• firstName
• address
• city
• state
• zip
• phone

Write the appropriate accessor and mutator functions for these member variables. Next, design a class named CustomerData , which is derived from the PersonData class. The CustomerData class should have the following member variables:

• customerNumber
• mailingList

The customerNumber variable will be used to hold a unique integer for each customer. The mailingList variable should be a bool . It will be set to true if the customer wishes to be on a mailing list, or false if the customer does not wish to be on a mail-ing list. Write appropriate accessor and mutator functions for these member variables.

Next write a program which demonstrates an object of the CustomerData class in a program. Your program MUST use exception handling. You can choose how to implement the exception handling. Organize your non object oriented code into a main function

Task 4
The class Polynomials is a collection of polynomials of either implementation stored in an instance of the
generic library class List.
class Polynomials
{
private List<Polynomial> L;
// Creates an empty list L of polynomials
public Polynomials ( )
{ … } (1 mark)
// Retrieves the polynomial stored at position i in L
public Polynomial Retrieve (int i) (1 mark)
{ … }
// Inserts polynomial p into L
public void Insert (Polynomial p) (1 mark)
{ … }
// Deletes the polynomial at index i
public void Delete (int i) (1 mark)
{ … }
// Returns the number of polynomials in L
public int Size ( )
{ … } (1 mark)
// Prints out the list of polynomials
public void Print ( )
{ … }
}

Provide a summary of WPA2 and WPA3. How is WPA2 more secure than WPA? How is WPA3 more secure than WPA2? Does WPA3 still have vulnerabilities?

What are the principle security hardening steps for a virtual machine environment?

7. Use the substitution & method of INSERT command to populate EMP_PROJ table. INSERT INTO EMP_PROJ VALUES (‘&empNo’, ‘&projNo’, &hoursWorked); NOTE: enclose &empNo in ‘ ‘ if the datatype is a string – VARCHAR2 or CHAR If empNo is NUMBER datatype then do not enclose &empNo in ‘ ‘!

(a) Assume that a polynomial-time primality testing algorithm, calledPrimes is available, which takes as input a single numbern >1 and outputs whethernis a primenumber or not. Now consider the following algorithm:

Input: A natural number n > 1

Algorithm Mystery(n)

if ( n mod 2 == 0 ) then

if (n == 2) then

output ‘‘Input is a prime number’’

   else ‘‘Input is not a prime number’’

else

Primes(n)

What is Algorithm Mystery trying to achieve? What is tightest possible lower bound that you can prove for Mystery and why? What is the tightest possible upper bound, assuming Primes(n)runs in quadratic time, that you can prove for Mystery and why? (b) Solve the recurrence T(n) =T(n/2) + 1 with the initial condition T(1) = 1. Show all steps. You may assume that is a power of 2 if it is convenient. Give one example of an algorithm whose time complexity can be expressed by this recurrence. Briefly explain what this algorithm does and how, and also what is its input.

Use attribute directives to display credit card logo based on the credit card number Use simplified rules as follows:

4 visa

5 mastercard

34 and 37 amex

30, 36, 38, 39 diners

60, 64, 65 discover

Discuss why naming conventions are important and why as a programmer you should consistently follow them. Include in this discussion, problems that could arise in naming variables if one convention is NOT followed.