Question

In: Statistics and Probability

1. Identify the errors in the Questionnaire and suggest the revised questions 2. Mention for each...

1. Identify the errors in the Questionnaire and suggest the revised questions
2. Mention for each question the scale of measurement (Nominal, ordinal, interval, Ratio)

BUSINESS WORLD

"Business World", a fortnightly magazine, is published from Bombay. It is brought out by management of Anand Bazaar Patrika Limited, Calcutta. In accordance with the decision taken in the annual editorial workshop of Business World held in early May 1986, a questionnaire was printed in some issues of Business World to know what readers thought of this magazine. By undel1aking a survey of this type, the management hoped to ascertain the strengths and weaknesses of the magazine. This would enable it "to tailor Business World to readers' requirements".

Questionnaire

Name:        _________________________________________________________________________________________

Profession:______________________________________________ Designation:______________________

Age;.................................. City:..................................................................... ,........................ ..........

Income:_____________

1. Which of these business magazines do you read? (please tick)

Regularly

Occasionally

Irregulgularily

Economic Times

Financial Express

Business Standard

Business World

Business India

Fortune India

Update

Others (specify)

2. My areas of interest are (Please tick. one or more)

Corporate and business affairs

(

)

Economic policy and development

(

)

Political affairs

(

)

People and lifestyles

(

)

Art literature

(

)

Investments

(

)

3. Rank the following magazines on a I to 5 scale (5 for very good, I for poor) for the following a!tributes:

Business World

Business India

Fortune India

Update         

1. Timeliness of information

2. Depth of information

3. Range of information

4. Depth of analysis

5. Language and style of presentation

6. Quality of printing and visuals.

4. How much time do you spend in reading an issue of Business World?

--------------Hours

5. How much of Business World do you read? (Please tick one)

(I) The entire magazine

(2) More than half the magazine

(3) More than a quarter of the magazine

(4) Less than a quarter of the magazine

6. Which of these features in Business World do you usually find interesting and read? (Please tick one or more)

(I) Cover Feature

(

)

(7) Editorial

(

)

(2) Spotlight

(

)

(8) Company News & Events

(

)

(3) Business News

(

)

(9) International Briefs

(

)

(4) In the News

(

)

(10) Entrepreneurs

(

)

(5) International News

(

)

(11) Leisure

(

)

(6) Off Stage

(

)

7. Which of these specialist pages in Business World do you read and find interesting? (Please look at the shoulder heads inside the magazine pages if you are not sure.)

(a)

Political comment

(g)

Careers and professionals

(b)

Banking and finance

(h)

Media trends

(c)

Econom ic comment

(i)

Book serial

(d)

Taxation

Ci)

Business information

(c)

Management

(k)

Marketing

(I)

Computers

(I)

Investment

8. In order to suit my requirements better, Business World should have

Fewer main features stores                                                        (               )

The same number of main feature stories                              (               )

At least one more main feature story                                      (               )

9. The lead features (cover and spotlight) should be

Shorter                                                                                           (               )

Same length                                                                                  (               )

Longer                                                                                           (               )

10. Business World's coverage of the following items (Please tick one column for each entry):

         Is adequate

Needs to be reduced

Needs to be expanded

Technology

Marketing

Management

Corporate Finance

Investment/Stock Markets

Book Reviews

Economic Policy

Policy Analysis

Corporate Performance

Corporate Case Studies

Behaviour

11. Do you buy your copy of Business World from the News-stands or are you a subscriber?

a) News-stands        b)Subscriber

I f (a), do you find it difficult to get a copy of Business World on the news-stands')

Yes ____                                                              No _______        

12. How soon after the magazine is published each fortnight do you receive your copy of Business World?

1 ~ 3 days                                                                                        3 - 6 days

6 - 12 days                                                                                        Longer than 12 days

13. Do you have any other suggestions to improve Business World

Solutions

Expert Solution

Here the revised questionnaire is ought to be as:

Note:

A good questionnaire must possess the following important characertistics:

Questions should be relelvant to the subject.
The number of questions must be limited.
Questions should not be dubious in meaning.
Multiple choice questions should mostly be included.

Name:        [nominal data] _____________________________________________________________ Age;..........[ratio]........................

City:..........[nominal].......................

Profession:_____[nominal]______________________________________

Income-________[ratio]_____________________________________

(note:-designation is not needed for this survey)

1. Your areas of interest are (Please tick. one or more)

Corporate and business affairs

Economic policy and development

Political affairs

People and lifestyles

Art literature

Investments

(all questions should either be in first person or second person)

[nominal data type]

2.Which of these business magazines do you read? (please tick)

1.regularly

2.occasionally

3.irregularly

Business world

Financial express

Economic times

Business standard

Business India

Fortune india

update

Others (specify)

(here your own newspaper should be preffered to be at the top)

[here the data type is of ordinal type]

3. Rank the following magazines on a I to 5 scale (5 for very good,4 for good,3 for fair,2 for poor, I for very poor) for the following a!tributes:

Business World

Financial express

Economic times

Business standard        

Business India

Fortune India

Update

Others(specify)

1. Timeliness of information

2. Depth of information

3. Range of information

4. Depth of analysis

5. Language and style of presentation

6. Quality of printing and visuals.

(the scale should be explained in details amd all the newspaper names mentioned earlier should be included)

[ordinal data type]

4.How much of Business World do you read? (Please tick one)

(I) The entire magazine

(2) More than half the magazine

(3) More than a quarter of the magazine

(4) Less than a quarter of the magazine

[ordinal data type]

5. How much time do you spend in reading an issue of Business World?

--------------Hours_______minutes.

[ratio data type,since zero time is meaningful]

(better to be precise, if reads then onky one can specify the time)

6. Which of these features in Business World do you usually find interesting and read? (Please tick one or more)

(I) Cover Feature

(7) Editorial

(2) Spotlight

(8) Company News & Events

(3) Business News

(9) International Briefs

(4) In the News

(10) Entrepreneurs

(5) International News

(11) Leisure

(6) Off Stage

[nominal data type]

7. Which of these specialist pages in Business World do you read and find interesting? (Please look at the shoulder heads inside the magazine pages if you are not sure.)(tick the prefferd ones)

(a)

Political comment

(g)

Careers and professionals

(b)

Banking and finance

(h)

Media trends

(c)

Econom ic comment

(i)

Book serial

(d)

Taxation

Ci)

Business information

(c)

Management

(k)

Marketing

(I)

Computers

(I)

Investment

[nominal data type]

8. In order to suit my requirements better, Business World should have

Fewer main features stores                                                        (               )

The same number of main feature stories                                 (               )

At least one more main feature story                                         (               )

[nominal data type]

9. Business World's coverage of the following items (Please tick one column for each entry):

1.        Is adequate

2.Needs to be reduced

3.Needs to be expanded

Technology

Marketing

Management

Corporate Finance

Investment/Stock Markets

Book Reviews

Economic Policy

Policy Analysis

Corporate Performance

Corporate Case Studies

Behaviour

                       [ordinal data type]

10. How soon after the magazine is published each fortnight do you receive your copy of Business World?

1 ~ 3 days                                                                                       

3 - 6 days

6 - 12 days                                                                                       

Longer than 12 days

[interval data type]

(please draw the tables. thank you)


Related Solutions

1. Matrix questions a. Questions in a questionnaire that allow the respondent to answer in his...
1. Matrix questions a. Questions in a questionnaire that allow the respondent to answer in his or her own words. b. Sets of questions in a questionnaire that use the same set of response categories. c. Questions in a questionnaire that force the respondent to select from a list of possible responses. d. Questions in a survey that depend on the responses to earlier questions or which have questions dependent on them.           2. In the study in...
Identify and correct the errors in each of the following statements: a) printf( "The value is...
Identify and correct the errors in each of the following statements: a) printf( "The value is %d\n", &number ); b) scanf( "%d%d", &number1, number2 ); c) if ( c < 7 );{ printf( "C is less than 7\n" ); } d) if ( c => 7 ) { printf( "C is greater than or equal to 7\n" );
explain this errors with example of each on: 1- error of omission 2- error of commission...
explain this errors with example of each on: 1- error of omission 2- error of commission 3- error of principles 4- error of original entry 5- error of reversal entries 6- addition errors 7- posting error 8- trial balance errors 9- compensating errors
Identify errors and correct them of the following Java program : 1. import java.utility.Random; 2. 3....
Identify errors and correct them of the following Java program : 1. import java.utility.Random; 2. 3. public class Sequen 4. 5. private int stand 6. private int calc; 7. 8. public Sequen(int numStand) 9. { 10. stand = numStand; 11. skip; 12. } 13. 14. public void skip() 15. { 16. Random sit = new Random(); 17. calc = sit.nextInt(stand) + 1; 18. } 19. 20. public getStand() 21. { 22. return stand; 23. } 24. 25. int getCalc() 26....
C PROGRAMMING Identify and correct the errors in each of the following. [Note: There may be...
C PROGRAMMING Identify and correct the errors in each of the following. [Note: There may be more than one error in each piece of code.] a) if ( sales => 5000 ) puts( "Sales are greater than or equal to $5000" ) else puts( "Sales are less than $5000 ) b) int x = 1, product = 0; while ( x <= 10 ); { product *= x; ++x; } c) While ( x <= 100 ) total =+ x;...
Directions: Identify the restriction sites for each of the examples given. Show the cuts, mention if...
Directions: Identify the restriction sites for each of the examples given. Show the cuts, mention if they are sticky ends or blunt, 5’ overhangs or 3 ‘overhangs and the number of DNA fragments produced and the number of base pairs in each (count the top row).             Remember: Analyze in the 5’à 3’ direction 1. HindII --- 5' GTC ↓GAC 3' 5' ACGACGTAGTCGACTTATTAT GTCGACCCGCCGCGTGTCGACCATCA 3' 3' TGCTGCATCAGCTGAATAATACAGCTGGGCGGCGCACAGCTGGTAGT 5' Number of pieces of DNA _______ 2. EcoRI --- 5' G ↓AATTC...
Answer the following questions thoroughly: 1) How well-crafted survey questionnaire should look like 2) What Are...
Answer the following questions thoroughly: 1) How well-crafted survey questionnaire should look like 2) What Are the Biases in response (Response style) to questionnaire surveys 3) What are the principles of scientific details (Mention them in details) 4) Define the terms in details, state their purpose and objectives, and provide  examples: a) Research Statement b) Research Question c) Research Hypothesis d) Research aim 5) What are the different types of sampling methods and when are they used. 6) Discuss and define...
1. The following program has syntactic errors. Identify the errors and correct them. Compile the corrected...
1. The following program has syntactic errors. Identify the errors and correct them. Compile the corrected program and submit a screeshot showing that the program has 0 (zero) errors. You can use  https://repl.it/languages/c  or  https://www.onlinegdb.com/ #include <stdio.h> int main (Void) {       INT sum;       /* Compute result       sum = 25 + 37 - 19;       // Display result       printf (“The answer is %i\n”, sum);       return 0; } // main 2. What is the purpose of a variable? a. To...
2. For each of the following research questions, identify the independent variable and the dependent variable...
2. For each of the following research questions, identify the independent variable and the dependent variable within each case (a through d): a.Does a person’s age affect psychological adjustment following burn injury? b. How do physically handicapped children differ from nonhandicapped children with respect to health concepts? c. Do patients with a family support system in place have lower pain ratings than patients with no family support system in place? d. Is the intracranial pressure of comatose patients affected by...
Identify errors and correct them of the following Java program: 1. import java.utility.Random; 2.   3. public...
Identify errors and correct them of the following Java program: 1. import java.utility.Random; 2.   3. public class Sequen 4.   5. private int stand   6. private int calc;   7.   8. public Sequen(int numStand) 9. { 10.         stand = numStand; 11.         skip; 12.         } 13.           14.         public void skip() 15.         { 16.         Random sit = new Random(); 17.         calc = sit.nextInt(stand) + 1; 18.         } 19.           20.         public getStand() 21.         { 22.         return stand; 23.         } 24.           25.         int getCalc() 26.         { 27.         return calc; 28.         } 29.         } Identify 5 other errors and give their Line Number, Error...
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT