1) At the cellular level, Mendel’s law of segregation (alleles of the same gene segregate into...

1)

At the cellular level, Mendel’s law of segregation (alleles of the same gene segregate into different gametes) would most correspond with ______

a)No DNA replication in the interphase between meiosis I and II

B)Homologous chromosomes separate in meiosis I

C)Sister chromatids separate in meiosis II

D)DNA replication in the interphase

2)Cytosine makes up 34% of the nucleotides in a sample of DNA from an organism. What percentage of the nucleotides in this sample will be thymine?

a)16

b)58

c)8

d)42

3)If a protein’s shape changes, _____

a)it will always become positively charged.

b)it will turn into a hydrogen.

c)it becomes a lipid.

d)it may lose its function.

4)Corona virus COVID-19 uses ____ to recognize a human host cell.

a)Reverse transcriptase

B)Spike proteins on the envelop

c)RNA genome

d)DNA genome

Expert Solution

gladiator answered 2 years ago

1. Mendel's Law of Segregation says this: Select one: alleles are always paired alleles separate during...

1. Mendel's Law of Segregation says this: Select one: alleles are always paired alleles separate during gamete formation alleles that are dominant get into gametes more often alleles that are recessive get into gametes more often alleles stay together during gamete formation 2. The use of the garden pea by Mendel was important because it has this ability. Select one: to produce only one color to have a few traits to focus on have several flower colors on one plant...

According to Mendel’s law, phenotypical characteristics are determined by pairs of factors (alleles) that separate independently...

According to Mendel’s law, phenotypical characteristics are determined by pairs of factors (alleles) that separate independently in gametes. What are the main types of inheritance that are exceptions to Mendel’s rules?

Define these 4 terms: alleles, gene expression independent assortment, and chromosomal segregation. Tell how they are related...

Define these 4 terms: alleles, gene expression independent assortment, and chromosomal segregation. Tell how they are related to one another in terms of genetics and meiosis.

You are looking at three alleles of the same gene. The mRNA derived from them is...

You are looking at three alleles of the same gene. The mRNA derived from them is shown below. Allele 1 - AUUCCCAUGACCCCCCCCUGA Allele 2 - CCCAUGACCCAUUAAAUCCCC Allele 3 - AUGACCCAUUAUAUCCCCUGA Rearrange the boxes below to place the alleles in the correct order with respect to the size of the polypeptide encoded. Largest on the top, smallest on the bottom. You may need a codon table to answer this question. You can find one here. Allele 3 Allele 1 Allele 2

What is/are the phenotypes when SALL4 gene is mutated at the cellular level? How does this...

What is/are the phenotypes when SALL4 gene is mutated at the cellular level? How does this genotype affect the phenotype of the cell?

1. compare law of independent assortment and law of segregation 2. (3 to 1 ratio) where...

1. compare law of independent assortment and law of segregation 2. (3 to 1 ratio) where does it come from? what is the parents genotype to get a 3 to 1 ratio? 3. what happens in deletion, duplication, inversion, and translocation? 4. if there's a mistake in the DNA and you want to fix it, what's the order of enzymes that need to be used in order to cut if off, repair it, seal it off?

Gene P has two alleles - P and p; gene Q has two alleles - Q...

Gene P has two alleles - P and p; gene Q has two alleles - Q and q. If an PQ/pq female is crossed with a pq/pq male, what percent of the offspring would have genotype pq/pq if... A) the genes were completely linked (no crossing-over at all; recombination frequency = 0; 1 mark) B) the genes are 10 map units apart (1 mark) C) the genes are 24 map units apart (1 mark) For either part (B) or (C)...

Question

1) At the cellular level, Mendel’s law of segregation (alleles of the same gene segregate into...

Solutions

Expert Solution

Related Solutions