Question

In: Biology

Using your current knowledge of genetics, make a list of some of the genes that all...

Using your current knowledge of genetics, make a list of some of the genes that all life forms may share.

Solutions

Expert Solution

All living organisms store genetic information using the same molecules- DNA and RNA. You're not completely human, atleast when it comes to the genetic material inside your cells. You- and everyone else- may harbor as many as 145 genes that have jumped from bacteria, other single celled organisms, and viruses and made themselves at home in the human genome. Believe it or not, plants and animals share many of the same genes- but we use some of them in different ways. For a good example of this, u need only look to the Eyes Absent (EYA) genes. These genes help flies build eyes, aid in humans development, and contribute to plant embryogenesis.

Our DNA is 99.9% the same as the person next to us- and we're surprisingly similar to a lot of other living things. Our bodies have 3 billion genetic building blocks, or base pairs, that make us who we are. While the egg laying and feathered body are pretty different form a human's body, about 60% of chicken genes have a human gene counterpart. Even bananas surprisingly still share about 60% of the same DNA as humans.

Due to billions of years of evolution, humans share genes with all living organisms. The percentage of genes or DNA that organisms share records their similarities. We sharr more genes with organisms that are more closely related to us.


Related Solutions

Describe the tenets of Mendelian genetics. Are these tenants held true for all genes?What are some...
Describe the tenets of Mendelian genetics. Are these tenants held true for all genes?What are some things that can cause exceptions to Mendelian genetics. Why do these cause complications?
Choose a local business in your area and make a list of its stakeholders. Are some...
Choose a local business in your area and make a list of its stakeholders. Are some more important than others? If so, list them in order of priority.
Before you read or reread this section in your text, make a list of all of...
Before you read or reread this section in your text, make a list of all of the qualities and characteristics that attract you to someone. Be honest and do not censor yourself. After you have made your list, read what psychologists have discovered about what attracts people to one another. How are these things reflected in your list? Did you learn something about why it is you view others the way you do? Can you illustrate these factors with personal...
Before you read or reread this section in your text, make a list of all of...
Before you read or reread this section in your text, make a list of all of the qualities and characteristics that attract you to someone. Be honest and do not censor yourself. After you have made your list, read what psychologists have discovered about what attracts people to one another. How are these things reflected in your list? Did you learn something about why it is you view others the way you do? Can you illustrate these factors with personal...
Using your knowledge of the business environment and relevant examples, explain some ways in which conducting...
Using your knowledge of the business environment and relevant examples, explain some ways in which conducting business in Canada maybe different from conducting business in South Sudan.
make a list of all the steps needed to calculate a confidence interval using a z-distribution.
make a list of all the steps needed to calculate a confidence interval using a z-distribution.
Choose one design method from the list below. Using your example, make a list of 2...
Choose one design method from the list below. Using your example, make a list of 2 or 3 advantages and 2 or 3 disadvantages for using the method. Cluster sampling The name of each student in a class is written on a separate card. The cards are placed in a bag. Three names are picked from the bag. Identify which type of sampling is used and why. A phone company obtains an alphabetical list of names of homeowners in a...
Using your knowledge of DNA replication, copy the following. Write down all the important steps and...
Using your knowledge of DNA replication, copy the following. Write down all the important steps and players of the reaction. Show the primer location and derive the complimentary strand sequence. 5` - AGATTCTGAGTCGTGACTCGTACGTCATAACTT -3`
please apply the knowledge you have got to make analysis of the current state of the...
please apply the knowledge you have got to make analysis of the current state of the four basics functions of the stock market in Morocco . write an article to introduce your analysis content thank you
1). please apply the knowledge you have to make analysis of the current state of the...
1). please apply the knowledge you have to make analysis of the current state of the four basic functions of the stock market in your country. you are required to write an article to introduce your analysis content . ------------------------------------------------------------- 2). analyse the current state of the four basics functions of Morocco's stock market . thank you
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT