Question

In: Biology

Scales of fish, reptile, bird, and mammal. Which scales are homologous (derived from same ancestral/embryonic structure)...

Scales of fish, reptile, bird, and mammal. Which scales are homologous (derived from same ancestral/embryonic structure) and which are not?

What embryonic layer they are from (dermal/mesoderm; epidermal/ectoderm)?

Solutions

Expert Solution

Scales of Fish: a) Placoid scales: It is found on cartilaginous fish, modern and early shark. Outer layer made up of vitrodentine(enamel like substance) and inner layer made up of dentine and pulp cavity included nerves and blood vessels. It have a toothlike structure. b)  Cosmoid scales:It is found on Sarcopterygians. Hard Outer layer made up of enamel and inner layer made up of cosmine and vascular layer isopendine.c) Ganoid scales : It is found on gars, bichirs, and reedfishes .Outer layer made up of ganoin (enamel like substance) and inner layer made up of cosmine and bony vascular layer. d)Cycloid scales : Thin and translucen bony scale have outer smooth edge found on  salmon and carp e) Clenoid Scale: like a cycloid scales have a tooth outer edge found on bass and crappie.

Scales of Reptile:Lizard Scales:Tubular,platelike and Overlapping.Outer sarface is horny and keratinized and underline with bony plates called as osteoderms.

Snake scales: entire body of snake is covered with scales and scutes which lack the osteoderms and scutes also found on turtle and crocodiles unlike the overlapping structure of snakes scales.Same dermal scutes are found in the feet of birds and tails of some mammals and are primitive form of dermal armour in reptiles.

Scales of Birds(Avian): The scales and scutes of birds were similar and homologous to those of reptiles,

Scales Of Mammals: Scales are consist of keratin and found on pangolin. Foot pad epidermal tissues in most mammal species homologous to avian reticulae are formed from stunted feathers.

Scales ofsome mammals and avian are homologues to each other but non homologous to fish and reptiles. Reptiles and mammals have same genes for scale but scales are not homologous.

During embyonic develompment scales are derived from the epidermal layer of mesoderm of embryo .


Related Solutions

List five characteristics, in order from ancestral to derived that occurred during the eye development. From...
List five characteristics, in order from ancestral to derived that occurred during the eye development. From early chordates' light sensitive pits to the current spherical evolved eye, in sharks for example.
How does the fish circulatory system differ from the mammal circulatory system? (Be comprehensive.) Name one...
How does the fish circulatory system differ from the mammal circulatory system? (Be comprehensive.) Name one significant feature that is the same between fish and mammal circulation.
How does the structure & function of the circulatory system in a fetal mammal differ from...
How does the structure & function of the circulatory system in a fetal mammal differ from that of the adult mammal? a. Where is fetal blood oxygenated and what is the pathway of oxygenated blood to the fetal heart? b. How does the structure of the fetal heart and the blood flow through the fetal heart differ from the adult?
You are looking at three alleles of the same gene. The mRNA derived from them is...
You are looking at three alleles of the same gene. The mRNA derived from them is shown below. Allele 1 - AUUCCCAUGACCCCCCCCUGA Allele 2 - CCCAUGACCCAUUAAAUCCCC Allele 3 - AUGACCCAUUAUAUCCCCUGA Rearrange the boxes below to place the alleles in the correct order with respect to the size of the polypeptide encoded. Largest on the top, smallest on the bottom. You may need a codon table to answer this question. You can find one here. Allele 3 Allele 1 Allele 2
Which of the following is true about the origin of birds? Answers: Bird fossils from the...
Which of the following is true about the origin of birds? Answers: Bird fossils from the late cretaceous period show a loss of dinosaur characteristics. Feathers were first adapted for insulation and coevolved with endothermy. Archaeopteryx is an important "intermediate" between a dinosaur and a bird. They belonged to a group of bipedal dinosaurs called theropods.
From which hypothesis the Euler-Lagrange equation is derived, analyze it and describe it briefly.
From which hypothesis the Euler-Lagrange equation is derived, analyze it and describe it briefly.
1. Briefly describe how respiration occurs in sharks. What structure, which allows a bony fish to...
1. Briefly describe how respiration occurs in sharks. What structure, which allows a bony fish to respire without moving, do they lack ? 2. Mushrooms undergo the fusion of nuclei (karyogamy) in specialized regions of the fruiting body called _________________.
1-why scientists were incorrect in hypothesizing that whales descended from a carnivorous mammal ? 2-Factors which...
1-why scientists were incorrect in hypothesizing that whales descended from a carnivorous mammal ? 2-Factors which limit the size of a population no matter how dense the population is are called ___________ limiting factors. An example would be ________
The synthesis of lipids in cancer cells is dependent upon mitochondrial citrate, which is derived from...
The synthesis of lipids in cancer cells is dependent upon mitochondrial citrate, which is derived from both glucose and glutamine. A)  True     B)  False
The synthesis of lipids in cancer cells is dependent upon mitochondrial citrate, which is derived from...
The synthesis of lipids in cancer cells is dependent upon mitochondrial citrate, which is derived from both glucose and glutamine. A)  True     B)  False
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT