Question

In: Biology

Briefly research one (1) of the following careers online: medical transcription, medical coding, medical billing, medical...

Briefly research one (1) of the following careers online: medical transcription, medical coding, medical billing, medical assisting (MA), nurse assisting (NAC). What roles does the professional play in a hospital setting? How are its jobs important to the billing life cycle and income of the institution? Post a link to information about medical coding, billing, MA or NAC that is touch-activated.

Solutions

Expert Solution

Medical transcription:

Medical transcription,also known as MT is an allied health profession dealing with the process of transcribing voice recorded medical reports that are dictated by physicians,nurses anad other healthcare practitioners.Medical reports can be voice files,notes taken during lecture,or other spoken material.These are dictated over the phone or uploaded digiatlly via the internet or through smart phone apps.

Medical transcription is a part of the healthcare industry that renders and edits doctors dictated reports,procedures and notes in an electronic format in order to create files representing the treatment history of patients.Health practioners dictate what they have done after performing procedures on patients and MT's transcribe the oral dictation and/or edit reports that have gone through speech recognition software.

Patient's up to date,confidential patient information is converted to a written text document by a medical transcriptionist.This text may be printed and placed in the patient's record and/or retained only in its electronic format.Medical trenacription can be performed by a MTs who are employees in a hospital or who work at home as telecommunicating employees for the hospital,or independent contractors for the outsourced service that perform the work offsite under contract to a hospital,clinic,physician group or other healthcare provider,or working directly for the providers of the service.The electronic storage in their database gives immediate access to sunsequent departments or providers regarding the patients care to date,or notation of previous medications.

The term transcript or "report" as it is more commonly called,is used as the name of the document which results from the medical trenacription process,normally in reference to the healthcare professionals specific encounter with the patient on specific date of service.This report is referred to by many as "medical report".Each specific transcribed record or report,with its own specific date of service,is then merged and becomes the part of the larger parient record commonly known as patient's medical history.

Medical transcription encompasses the MT,performing document typing and formatting functions according to an established criterion or format,transcribing the spoken word of the patient's care information into the written,easily readable form.MT requires correct spelling of all terms and words,correcting the medical technology or dictation errors.All transcriptio reports must comply with medico-leal concerns,policies and procedures,and laws under patient confidentiality.

In transcribing directly for a doctor or a group of physicians,there are specific formts and reports types used,depending on that doctor's speciality of practice,although history and physical exams or consults are mainly utilized.

Medical transcription is still the primary mechanism for physician to clearly communicate with other healthcare providers who access the patient's record,to advise them on the state of patient's health and past/current treatment,and to assure continuity of care.More recently,a written report(IME) become the requirement for the documentation of medical bll or application for worker's compensation insurence benifits based on requirements of federal and state agencies.

It is very important to have properly formatted,edited and reviewed medical transcription document.If medical transcriptionist accidentally typed a wrong medications or wrong diagnosis ,the patient could be at risk if the doctor dis not review the document for accuracy.Both the doctor and MT play and important role to make sure the transcribed dictation is correct and accurate.

Medical transcription editing is the process of listening to a voice-recorded file and comparing that to a transcribed report of that audio file,correcting errors as needed.Medical transcription editing is also performed on medical reports transcribed by medical transcriptionist.


Related Solutions

Medical Billing and Coding:   Respond to the discussion question with a substantive post. Cost of Health...
Medical Billing and Coding:   Respond to the discussion question with a substantive post. Cost of Health Care in the US In the news, there has been discussion regarding the cost of health care in the United States. Conduct research on this topic and provide the reasons and rationale for what drives health care costs in the United States. What can be done to control the cost of healthcare? What can health care facilities do to manage the cost of health...
how are the medical coding and billing functions affected? what training and development are needed?
how are the medical coding and billing functions affected? what training and development are needed?
Medical coding and billing is a significant element that benefits; health insurance companies, healthcare providers and...
Medical coding and billing is a significant element that benefits; health insurance companies, healthcare providers and institutions, patients, and public health. Explore the benefits of these four areas.
Healthcare Insurance Coding, Billing, and Reimbursement Introduction: In order to properly code a bill for medical...
Healthcare Insurance Coding, Billing, and Reimbursement Introduction: In order to properly code a bill for medical necessity, it is important to understand different plans and the requirements for billing each. It is true that they all use the ICD-10-CM diagnosis coding system, the CPT procedure coding system, and the CMS-1500 form, but each type of carrier has certain requirements for a clean bill. Tasks: Create a billing manual constructed of summaries of each type of insurance. Include the major requirements...
Discuss with class, Addressing Medical Coding and Billing Part II: A Strategy for Achieving Compliance. A...
Discuss with class, Addressing Medical Coding and Billing Part II: A Strategy for Achieving Compliance. A Risk Management Approach for Reducing Coding and Billing Errors"
Medical Coding and Billing In a word document write (600 - 900 Words) Using APA Referencing...
Medical Coding and Billing In a word document write (600 - 900 Words) Using APA Referencing style, Discuss the following: The Centers for Medicare and Medicaid Services (CMS) released the results from their Comprehensive Error Rate Testing (CERT) earlier this year 2018. The results showed a 9.5% overall improper payment rate for 2017, representing $36.21 billion in improper payments. If any medical practice received some of these improper payments, They could be forced to provide a refund plus incur other...
1.Explain to a layperson how medical coding works. What is the purpose of medical coding? Include...
1.Explain to a layperson how medical coding works. What is the purpose of medical coding? Include CPT codes, HCPCS, and ICD-10 codes. 2. explain medical coding and billing to a person not in the healthcare field
11.4 1.   How does the medical billing specialist handle billing if the member also has other...
11.4 1.   How does the medical billing specialist handle billing if the member also has other insurance ? 2.   What purpose would supplemental insurance policies serve for Tricare beneficiaries ? 18.   What are the costs for Tricare extra ?
what is the future of medical coding? Consider the following: (1) the rapid changes in technology,...
what is the future of medical coding? Consider the following: (1) the rapid changes in technology, (2) new standards development, (3) value-based care and the cost-driven environment, and (4) the consumers' demand for information and quality.
On the sequence below: 1. Indicate the direction of transcription 2. Indicate which is the coding...
On the sequence below: 1. Indicate the direction of transcription 2. Indicate which is the coding strand and which one is the template for the transcription 3. Write down the mRNA 4. Write down the protein clearly indicating the first codon on the mRNA(hint: find the Kozak sequence RCCAUGG to identify the first codon) 5. Introduce a nonsense mutation 3' AGTCGACTGGCATCAGACTACGCTGTGACTGATACGCGTTTTATTGGATCGCACCGCATACAGGGCCCCGGTACCGTCCAAAACT CCCGAGTAGTCAGATGTCAGCAGCGAAATATACGG 5' 5'TCAGCTGACCGTAGTCTGATGCGACACTGACTATGCGCAAAATAACCTAGCGTGGCGTATGTCCCGGGGCCATGGCAGGTTTTGAGGGCTCATCAGTCTACAGT CGTCGCTTTATATGCC 3'
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT